ID: 926890879

View in Genome Browser
Species Human (GRCh38)
Location 2:17637880-17637902
Sequence AGGTTGACGCAGCACTTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926890874_926890879 13 Left 926890874 2:17637844-17637866 CCAACCACAGACAGAATGACCTT 0: 1
1: 0
2: 1
3: 23
4: 259
Right 926890879 2:17637880-17637902 AGGTTGACGCAGCACTTTCCCGG 0: 1
1: 0
2: 1
3: 4
4: 64
926890875_926890879 9 Left 926890875 2:17637848-17637870 CCACAGACAGAATGACCTTTGCT 0: 1
1: 4
2: 24
3: 98
4: 320
Right 926890879 2:17637880-17637902 AGGTTGACGCAGCACTTTCCCGG 0: 1
1: 0
2: 1
3: 4
4: 64
926890873_926890879 26 Left 926890873 2:17637831-17637853 CCTGGTAAATATTCCAACCACAG 0: 1
1: 1
2: 0
3: 12
4: 124
Right 926890879 2:17637880-17637902 AGGTTGACGCAGCACTTTCCCGG 0: 1
1: 0
2: 1
3: 4
4: 64
926890877_926890879 -6 Left 926890877 2:17637863-17637885 CCTTTGCTGAGTCCTTGAGGTTG 0: 1
1: 0
2: 0
3: 34
4: 460
Right 926890879 2:17637880-17637902 AGGTTGACGCAGCACTTTCCCGG 0: 1
1: 0
2: 1
3: 4
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926890879 Original CRISPR AGGTTGACGCAGCACTTTCC CGG Intronic
906809523 1:48811843-48811865 GGGTTGACACAGCAGTGTCCAGG + Intronic
907090952 1:51724863-51724885 AGGTTGACGCAGTGCTTTAAGGG - Intronic
908142281 1:61198686-61198708 ATGTTGGCAGAGCACTTTCCAGG + Intronic
913230473 1:116736801-116736823 AGGTAGATGCAGGACCTTCCAGG - Intergenic
920377773 1:205518603-205518625 AGAATCACGCAGCAATTTCCTGG - Intronic
920512373 1:206560562-206560584 AGGCTGAGGCAGTACTCTCCTGG + Intronic
1064160431 10:12940863-12940885 AGGCTTACCCAGCACTGTCCAGG + Intronic
1064895880 10:20235886-20235908 AGGCCGACGAAGCACTTTCAAGG - Intronic
1066656877 10:37704875-37704897 AGGGTGAGGAAGCCCTTTCCAGG - Intergenic
1067041403 10:42955113-42955135 AGGGTGAGGAAGCCCTTTCCAGG - Intergenic
1069194265 10:65528818-65528840 AAGTTGTCTCAGCACTTTTCAGG - Intergenic
1075724324 10:124603806-124603828 AGGTTGACTCAGCAGTCCCCAGG + Intronic
1083631121 11:64096022-64096044 AGTTTGAAGCAGCACTGTGCTGG - Intronic
1088232317 11:107685748-107685770 ATAATGATGCAGCACTTTCCAGG - Intergenic
1090399986 11:126442938-126442960 AGGTTGAATCTGCACTCTCCAGG - Intronic
1090484303 11:127098841-127098863 GGGCTGATTCAGCACTTTCCTGG + Intergenic
1092245687 12:6863123-6863145 AGGTTCCCGAATCACTTTCCAGG + Intronic
1120434194 14:84459429-84459451 AGGTTGTATCAGCACTTTGCAGG - Intergenic
1124963391 15:34414890-34414912 TGGTTGACCCAGCCCCTTCCTGG + Intronic
1124980012 15:34561116-34561138 TGGTTGACCCAGCCCCTTCCTGG + Intronic
1125425425 15:39543819-39543841 TAGCTGACTCAGCACTTTCCTGG - Intergenic
1128399547 15:67264158-67264180 TGGTAGAGGCAGCCCTTTCCTGG + Intronic
1130386076 15:83413617-83413639 ATGTTGTTGAAGCACTTTCCTGG + Intergenic
1134660068 16:15977263-15977285 TGGGTGATGCAGCATTTTCCTGG + Intronic
1135471206 16:22732766-22732788 AGGCTGAAGCAGAGCTTTCCGGG + Intergenic
1137813705 16:51377826-51377848 AGTTTGGAGCAGGACTTTCCAGG + Intergenic
1138814322 16:60186801-60186823 TGGTTGATGCAGAAATTTCCAGG - Intergenic
1140944712 16:79757262-79757284 AAGTTGATGGAGCACTTTCCTGG + Intergenic
1140999760 16:80297371-80297393 AGGTTGAGGAACCCCTTTCCAGG - Intergenic
1146690002 17:34866829-34866851 AGGGTGAAGCAGAGCTTTCCAGG - Intergenic
1153049415 18:887225-887247 AAGTTGACGCTGCAGTTTTCAGG - Intergenic
1154307392 18:13240447-13240469 AGGCTGAAGCAGCACCTCCCAGG - Intronic
1155142101 18:23052958-23052980 ACCTTGATGCTGCACTTTCCTGG - Intergenic
1156481039 18:37436583-37436605 AGGTGGCCCCAGCACTTCCCTGG + Intronic
1159134664 18:64322811-64322833 AGGTTAACACAGCACTGTCCTGG + Intergenic
1161889295 19:7022986-7023008 AGGATGACACACCACTTCCCTGG + Intergenic
1161892157 19:7047761-7047783 AGGATGACACACCACTTCCCTGG - Intergenic
1162592317 19:11599950-11599972 AGGTTAGCGCAGCCCCTTCCTGG + Intronic
926890879 2:17637880-17637902 AGGTTGACGCAGCACTTTCCCGG + Intronic
1174332375 20:49830481-49830503 ATGTCCACGTAGCACTTTCCAGG - Intronic
1184905922 22:47486678-47486700 AGGTTGGGACAGCACCTTCCAGG - Intronic
1185340333 22:50288118-50288140 AGCTTGACCCAGCTCTGTCCCGG + Intronic
955655022 3:61236093-61236115 ATCTTGACTTAGCACTTTCCTGG - Intronic
956894074 3:73641726-73641748 AGGTTGAAGCAGAAGTTTGCTGG + Intergenic
957010216 3:74996427-74996449 AGGTTGAAGTAGGACTTTCCAGG - Intergenic
962616319 3:137130349-137130371 AGGTTGAGTCAGAGCTTTCCAGG + Intergenic
974895758 4:67936385-67936407 AGGTTGACTAAGCTCTATCCAGG - Intronic
980319783 4:131256312-131256334 AAGTTGATGGAGCTCTTTCCCGG + Intergenic
984795806 4:183659176-183659198 AGGGAGACGCTGCACTTCCCAGG - Exonic
996400067 5:123052740-123052762 AGGTGAAAGCAGCACTTTCGAGG - Intergenic
1004550252 6:16639653-16639675 TGGTTGAAGCTGCACTTCCCTGG - Intronic
1005311636 6:24564573-24564595 AAGTTTACCAAGCACTTTCCAGG + Intronic
1007127118 6:39434777-39434799 AGGATGAAGCAGCATTTCCCAGG + Intronic
1013122073 6:107149913-107149935 AGTTTGACAAAGCAGTTTCCTGG - Intergenic
1018444071 6:163839326-163839348 AGGTTGAAGCAGCACTGGACGGG - Intergenic
1025116826 7:56265266-56265288 AGGGTTACTCAGGACTTTCCTGG + Intergenic
1025234248 7:57223176-57223198 AGGTTTGCCCAGAACTTTCCCGG - Intergenic
1026201245 7:68216304-68216326 AGGATTACTCAGGACTTTCCTGG + Intergenic
1027591640 7:80126250-80126272 AGGCTGGCAGAGCACTTTCCAGG - Intergenic
1027830497 7:83170894-83170916 ATGTTGAAGCAGCACTTTCCGGG - Intergenic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1028239150 7:88398245-88398267 CTGTTTACCCAGCACTTTCCAGG - Intergenic
1039449474 8:37660252-37660274 TGGTTGGCTCAGAACTTTCCTGG + Intergenic
1042715335 8:71766007-71766029 AGGTTTACTCAGGACTTGCCTGG - Intergenic
1046717258 8:117581335-117581357 AGGTCGACGCAGCAGTTACCAGG + Intergenic
1062171572 9:135137630-135137652 AGCGTGACTCAGCACTTTCATGG - Intergenic
1196002150 X:110796855-110796877 CTGTCGAGGCAGCACTTTCCTGG - Intergenic
1197121999 X:122905104-122905126 AGATTCACTCACCACTTTCCTGG - Intergenic
1197758022 X:130009873-130009895 TGGTTGACCCAGCTCTTCCCGGG + Intronic
1199846965 X:151698658-151698680 AGGTTGAAGCAGCACCTTGTGGG - Exonic