ID: 926891011

View in Genome Browser
Species Human (GRCh38)
Location 2:17638853-17638875
Sequence GCATAGGAGGGCCCCTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926891000_926891011 26 Left 926891000 2:17638804-17638826 CCTTAGGGAAAGGAATAATCAAG 0: 1
1: 0
2: 0
3: 22
4: 277
Right 926891011 2:17638853-17638875 GCATAGGAGGGCCCCTTCCCAGG 0: 1
1: 0
2: 1
3: 20
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926891011 Original CRISPR GCATAGGAGGGCCCCTTCCC AGG Intronic
900148444 1:1168170-1168192 GCAGAGGCCGGCCCCTCCCCTGG - Intergenic
900362903 1:2298528-2298550 GCAGAGGCGGGACCCTGCCCGGG + Intronic
900565756 1:3331134-3331156 GCAGAGGAAGGCCCCCTCCCAGG - Intronic
901005611 1:6170340-6170362 GGACAGGAGGGCTCCTACCCTGG + Intronic
901038443 1:6350049-6350071 GCATCTCAGGGCCCCTTCCGTGG - Intronic
901206112 1:7496811-7496833 GCCTGGGAGGCCTCCTTCCCTGG - Intronic
901236259 1:7669265-7669287 GCCTGGGAGAGCCCCTTCCGTGG + Intronic
902813687 1:18903940-18903962 CCACAGGAGGTCACCTTCCCAGG - Intronic
903064292 1:20690135-20690157 GGAAAGGAGGCCACCTTCCCTGG + Intronic
903229586 1:21913653-21913675 TCCTAGGATGGCTCCTTCCCTGG - Intronic
903543587 1:24110199-24110221 GCATGGGAGGGTTCCTGCCCAGG + Intronic
904290013 1:29478732-29478754 GCAGAGGAGGGGCTCTTCCCAGG - Intergenic
904413771 1:30342620-30342642 GCAGAGGAGGGGCTCTTCCCAGG + Intergenic
905853598 1:41292319-41292341 GCATAGGAGAGCCACCTGCCTGG + Intergenic
906060228 1:42943673-42943695 GCATAGGAGGGCTGGTTCCTGGG - Intronic
907347540 1:53795236-53795258 CCATTGGAGGGCCCCTTTCTTGG + Intronic
911058116 1:93724689-93724711 GGAGAGGTGGGCCCCTTCTCTGG + Intronic
912386324 1:109272937-109272959 GAAGAGGAGGCCGCCTTCCCTGG + Exonic
913237882 1:116800494-116800516 GAGTGGCAGGGCCCCTTCCCTGG - Intergenic
913475114 1:119229681-119229703 GAGAAGGAGGGCCCATTCCCTGG - Intergenic
915308075 1:154992627-154992649 CCATGGATGGGCCCCTTCCCAGG + Intronic
1065407784 10:25388792-25388814 GCAAGGGAGGGGGCCTTCCCAGG - Intronic
1069722524 10:70559014-70559036 GCGTAGGAGGGCCGTGTCCCTGG + Intronic
1071715662 10:88092924-88092946 ACATAGGAGGGCCCTAACCCAGG + Intergenic
1072856327 10:98951412-98951434 GCAAAGGAGGGACACTTCCTTGG - Intronic
1076351175 10:129816137-129816159 GCAGGAGACGGCCCCTTCCCTGG + Intergenic
1076883715 10:133251921-133251943 CCACAGCAGGGCCCCTGCCCAGG - Intergenic
1076887703 10:133270128-133270150 CCCCAGGAGGGCCACTTCCCAGG - Intronic
1077102084 11:826964-826986 GGACAGGAGGGGCCCCTCCCAGG + Intronic
1077253613 11:1571400-1571422 ACAGGGGAAGGCCCCTTCCCGGG + Intronic
1077330581 11:1982328-1982350 GCAAAGGAGAGGCCCTTTCCAGG + Intronic
1077517124 11:3008763-3008785 GCTGAGGAGGGCCTGTTCCCAGG - Intronic
1081647607 11:44800732-44800754 TCCTAGGAAGGCCCCTTCTCAGG - Intronic
1081873240 11:46392469-46392491 GCAGGGGCGCGCCCCTTCCCCGG - Intergenic
1084176125 11:67423285-67423307 GCCTAGGATGGCCCCTTCAGGGG - Intronic
1084490907 11:69477777-69477799 GGATAGGAGGGTTCCTGCCCAGG + Intergenic
1088099098 11:106134730-106134752 TCATAGCAGAGCCCCTTCCCAGG + Intergenic
1089996511 11:122912975-122912997 GGTTAGAAGGGCCTCTTCCCTGG - Intronic
1091315756 11:134612868-134612890 GCATATGAGCGCCATTTCCCGGG - Intergenic
1202813559 11_KI270721v1_random:37507-37529 GCAAAGGAGAGGCCCTTTCCAGG + Intergenic
1094288164 12:28817306-28817328 ACACAGGAGGGTCCCTTCCCTGG - Intergenic
1095900710 12:47325303-47325325 CTATAGGTAGGCCCCTTCCCTGG - Intergenic
1096175857 12:49518219-49518241 GAATAGCAGAGTCCCTTCCCTGG + Intronic
1096634518 12:52949767-52949789 GCATGGGAGGGCTCTTTCCCAGG + Intronic
1096817520 12:54210789-54210811 GCATGTGAGGGCCTCTTCCCTGG + Intergenic
1097422845 12:59402138-59402160 GCATAGCAGGGCATTTTCCCTGG + Intergenic
1100820092 12:98422212-98422234 CCCAAGGAGGGTCCCTTCCCTGG - Intergenic
1103210226 12:119160177-119160199 GCAAGGGAGTGCCCCTTTCCTGG + Exonic
1103955488 12:124574168-124574190 GCACAGGAGGGCCCCATCAAGGG + Intergenic
1106546729 13:30737324-30737346 GCAGAGCAGGGCCAGTTCCCTGG - Intronic
1106606530 13:31234375-31234397 ACAAAGGAGGGCCCCTACCATGG + Intronic
1106634105 13:31508772-31508794 GCCTGGGTGGGCCCCTTCTCTGG + Intergenic
1107664773 13:42677527-42677549 ACTAAGGAAGGCCCCTTCCCAGG + Intergenic
1107789645 13:43988872-43988894 CCAAAGGAGGGCTACTTCCCCGG + Intergenic
1110780480 13:79459589-79459611 GCATAGGAGGGTCCTTCCCTGGG - Intergenic
1111221528 13:85210474-85210496 GCATGGGAGCGTTCCTTCCCAGG + Intergenic
1114209849 14:20605275-20605297 ATATAGGAGGGTCCCTTACCTGG - Intronic
1118617784 14:67586781-67586803 TCTTAAGAAGGCCCCTTCCCTGG + Intronic
1120420841 14:84284016-84284038 TCTGAGGAGGGCCCCTTCCCAGG - Intergenic
1121300007 14:92862695-92862717 GGGTAGGAGGGGCCCTGCCCAGG - Intergenic
1124002299 15:25769565-25769587 GGGTAGGATGGCCACTTCCCCGG - Intronic
1131573631 15:93564501-93564523 GCTTAGAAGGGCCCCATGCCTGG + Intergenic
1133210286 16:4259936-4259958 GCCTTGGGGGGCCCCGTCCCTGG - Intronic
1133284432 16:4683983-4684005 TCAGAGCAGGGCCCCCTCCCTGG - Intronic
1136146478 16:28319508-28319530 TCCTCTGAGGGCCCCTTCCCAGG - Intronic
1141645703 16:85366304-85366326 GCACAAGAGCCCCCCTTCCCTGG + Intergenic
1142276936 16:89123744-89123766 GGATGGGAGGACACCTTCCCAGG + Intronic
1145250854 17:21296261-21296283 GCAGAGGAGGGCACCATGCCAGG + Intronic
1146808006 17:35880625-35880647 TCTGAGGAGGACCCCTTCCCTGG - Intronic
1147307458 17:39573818-39573840 GCATCTGCAGGCCCCTTCCCCGG + Intergenic
1148203945 17:45767953-45767975 GCATAGGAGGGCACCGGCCTGGG - Intergenic
1150124343 17:62627128-62627150 GCCGAGGAGGACCCCTCCCCCGG - Intergenic
1151774422 17:76189743-76189765 GCTTCGGAGGGTCCCTTCTCCGG - Intronic
1152605566 17:81287942-81287964 GCCTGGGCGGGCCCCTTCCTGGG - Intronic
1153156018 18:2149764-2149786 TCATAGGATGCCACCTTCCCTGG + Intergenic
1156489692 18:37488869-37488891 GCCCAGGAGAGCCCCTTCCCAGG + Intronic
1157583558 18:48787214-48787236 GCAAAGGAGGGGCCCAGCCCAGG + Intronic
1160872877 19:1285211-1285233 GCAGGGGAGGGCCGCTGCCCGGG - Intergenic
1161383127 19:3977022-3977044 GGATAGGAGAGCCCCTCCCCTGG + Intronic
1161662768 19:5557464-5557486 ACAAAGAAGGGCCCCTTCCTGGG + Intergenic
1163421579 19:17216317-17216339 GCACGGTAGGGCTCCTTCCCTGG + Exonic
1166259367 19:41627117-41627139 GCAGAGGCGGGGCTCTTCCCAGG + Intronic
1166392062 19:42413899-42413921 GGAGAGGACGGCCCCTCCCCAGG + Intronic
1168502257 19:56903040-56903062 GCATAGGAGGTTGCCTTGCCTGG + Intergenic
925168931 2:1739017-1739039 GCTGATGAGGGCCCCTTACCTGG - Intronic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
926891011 2:17638853-17638875 GCATAGGAGGGCCCCTTCCCAGG + Intronic
929214334 2:39394885-39394907 GCACAGGAAAGCCCCTTTCCAGG - Intronic
930096535 2:47570560-47570582 GCAGAGGAGCGCCCCTGCCCGGG - Exonic
932791828 2:74660418-74660440 GCATAGGAAGGACCTTTCCCAGG - Intronic
934993219 2:98935974-98935996 GCAGAGAAGGGCACCTTCCGCGG + Exonic
937072780 2:119076882-119076904 GCATGGGAAGGCCACTTCCGGGG - Intergenic
938342399 2:130544308-130544330 GGCTAGGAGGGCCCCTGCTCTGG - Intronic
938347433 2:130576401-130576423 GGCTAGGAGGGCCCCTGCTCTGG + Intronic
939932809 2:148255360-148255382 CCAGAGGAGGGCTCTTTCCCTGG + Intronic
941646615 2:168047759-168047781 GCATTGGAGGGCTTCTGCCCTGG - Intronic
942779313 2:179622527-179622549 GCTTGGGAGGGCATCTTCCCAGG + Intronic
943699950 2:190978887-190978909 GAATGTGATGGCCCCTTCCCGGG + Exonic
944478430 2:200130116-200130138 GCTTAGGATGGCTCCTCCCCAGG + Intergenic
947932153 2:233973107-233973129 ACATAGCAGGGCCCCGTCCTGGG - Intronic
948838105 2:240635997-240636019 TCCTAGGAGGGCCCATGCCCAGG + Intergenic
948858936 2:240743588-240743610 GCACAGCTGGGCCCCTTTCCTGG + Intronic
948958623 2:241315183-241315205 GCACAGGAAGGCCACGTCCCCGG + Intronic
1172647976 20:36483419-36483441 GCAGAGCAGGGACCCTTGCCTGG - Intronic
1172836641 20:37877553-37877575 ACAGAGGAGGGCCCCATGCCTGG + Intergenic
1175224479 20:57437091-57437113 GCTAAGGAGGGCCCTTGCCCAGG - Intergenic
1176187222 20:63787453-63787475 GCATGGCAGGGGCCCTACCCAGG + Intronic
1177651361 21:23965075-23965097 CCGGAGGAGGGTCCCTTCCCTGG + Intergenic
1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG + Intronic
1179209724 21:39314222-39314244 GCATACGAGGCCCCCGCCCCAGG - Intronic
1179710527 21:43210614-43210636 GGATAGGAGGGGCCCTCCCCAGG + Intergenic
1181393269 22:22599417-22599439 GGAGAGGAAGGCCCCTCCCCAGG + Intergenic
1183027843 22:35079564-35079586 ACATACGAGGCTCCCTTCCCTGG + Intronic
1183431093 22:37766161-37766183 TCATAGGAGTGCCTCCTCCCTGG + Intronic
1183829154 22:40408839-40408861 GCAGAGGAGGCCCCCTTACCCGG - Exonic
1184039254 22:41933512-41933534 GCACAGGAGGCAGCCTTCCCTGG - Intergenic
1184362208 22:44025237-44025259 CTATGGGAGGGCTCCTTCCCGGG - Intronic
954570589 3:51637594-51637616 GAGTAGGAGGGCCCCTTCCCTGG + Intronic
969219377 4:5749679-5749701 GCATCAGAGGGCTCGTTCCCTGG - Intronic
970315035 4:14821055-14821077 TCATATGTGGGCCCCTTCCCAGG + Intergenic
971631594 4:28999428-28999450 TCATAGGAGGGACCCTTCTGTGG + Intergenic
972862072 4:43181473-43181495 CCTTAGGAGGGTCCCTTTCCTGG + Intergenic
974402621 4:61425715-61425737 ACAGAGGAGGGTTCCTTCCCTGG + Intronic
975762345 4:77632268-77632290 CCAGAGGAGGGTCCCTTCTCTGG + Intergenic
985764776 5:1771491-1771513 CCATAGGAGGTCCCCTTGGCAGG + Intergenic
987317346 5:16735962-16735984 GCAGATCAGGGCCCCTTTCCAGG + Intronic
988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG + Intronic
993719825 5:91311326-91311348 ACAGAGGAAGGCCCCTGCCCCGG + Intergenic
997294632 5:132761896-132761918 GCATACCCGGGCCCCTTTCCAGG - Exonic
997884700 5:137619829-137619851 TCAGTGGAGGGACCCTTCCCCGG + Exonic
998182232 5:139953724-139953746 TCGTAGGAGGGCCCCAGCCCGGG + Intronic
999243560 5:150140982-150141004 GCAATGCAGGGCCCCCTCCCTGG - Intronic
999370495 5:151052289-151052311 GGAAAGGAGGGGCCCCTCCCAGG + Intronic
1000297615 5:159925894-159925916 GCATTGCAGGGCCCCTGCTCAGG + Intronic
1001520017 5:172384876-172384898 GTCTAGTAGGGCACCTTCCCTGG + Intronic
1002381271 5:178831666-178831688 GAAGAGAAGGGCCCCTTCCTCGG + Intergenic
1003460105 6:6320938-6320960 GCACTGCAGGGCCCCTTGCCTGG - Intronic
1003636053 6:7832437-7832459 GCTGATGAGGGCCTCTTCCCTGG - Intronic
1006271056 6:32968214-32968236 GGAGAGAGGGGCCCCTTCCCTGG - Intronic
1006867694 6:37222432-37222454 CCCCAGGAGGCCCCCTTCCCCGG - Intronic
1007709640 6:43814157-43814179 GCACAGGAGGGCCTGTGCCCAGG - Intergenic
1008591156 6:52995054-52995076 GCAGAGGTGGGCCCCTTGGCTGG - Intronic
1008815004 6:55554725-55554747 GGCAAGGAGGACCCCTTCCCTGG - Intronic
1008840127 6:55892968-55892990 GCAAAGGAGGAGCCCTCCCCTGG - Intergenic
1009895737 6:69746636-69746658 GCATTGGAGGGTCCCTTCAAAGG + Intronic
1010723467 6:79309290-79309312 TCAGAGGAGGGCTCCTTCCCTGG + Intergenic
1013738918 6:113260300-113260322 GCTCAGGAGGGCCTCTTCCGTGG - Intergenic
1014126812 6:117785798-117785820 ACATAGATGGGCCCCTACCCTGG - Intergenic
1018810318 6:167293971-167293993 GGATACGAGGGCCACGTCCCTGG + Intronic
1019136103 6:169908695-169908717 GCAGAGCACGGCCCCTTGCCAGG - Intergenic
1019594472 7:1852070-1852092 CCTCAGGAGGGCCCCTCCCCAGG - Intronic
1021355736 7:19651444-19651466 GCCTCTGGGGGCCCCTTCCCAGG - Intergenic
1023075153 7:36474427-36474449 CCAGAGAAGGGTCCCTTCCCTGG + Intergenic
1030169584 7:106588132-106588154 GCATAGGCAGGCCCCATCCAGGG - Intergenic
1033156480 7:138961256-138961278 ACATAGGAGGGCTCCATGCCAGG + Intronic
1034590675 7:152136425-152136447 TCATAGGAAGGCCCCTGCCCGGG + Exonic
1039125540 8:34197254-34197276 GCAGAGGAGGGAACCTGCCCAGG - Intergenic
1043372856 8:79613060-79613082 GCAGAGGTGACCCCCTTCCCAGG + Intronic
1044517528 8:93156615-93156637 GCAAATGAGGGAACCTTCCCAGG + Intronic
1045414689 8:101954126-101954148 CCATAGGACGGCCCATACCCTGG - Intronic
1048544787 8:135376774-135376796 GAATAGGTGGGCCACTTCCTAGG - Intergenic
1049709324 8:144056570-144056592 AGACAGGAGGGCCCCTTGCCAGG + Intronic
1050431979 9:5571487-5571509 GCATAGGTGGGCTTCTTCCAGGG - Intergenic
1058138903 9:101337942-101337964 GCAGGGGAAGGCCCTTTCCCAGG - Intergenic
1061632736 9:131883392-131883414 ACAGTGCAGGGCCCCTTCCCTGG - Intronic
1061782637 9:133004840-133004862 CCAGAGGAGGCCCCCCTCCCAGG - Intergenic
1062281615 9:135754452-135754474 GCAAAGGAAGGCACCTGCCCCGG + Intronic
1062388524 9:136324839-136324861 GCTTGGGAGGGCCCCTCCCCAGG + Intergenic
1186194802 X:7099692-7099714 GTATAGGAGGGCTCTTTGCCTGG - Intronic
1187276293 X:17819006-17819028 GAAGAGGAGGGCCCCTGCGCAGG - Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1192522489 X:71814778-71814800 CCATTAGAGGGCCCCTACCCCGG + Intergenic
1193022031 X:76801425-76801447 CCAGGGGAGGGTCCCTTCCCTGG - Intergenic
1196896033 X:120336926-120336948 GCATAGGATTTCCCATTCCCAGG - Intergenic