ID: 926897432

View in Genome Browser
Species Human (GRCh38)
Location 2:17709629-17709651
Sequence GTGCTGTTCCAGAGGATAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926897428_926897432 -8 Left 926897428 2:17709614-17709636 CCTACTCTGTGCCAGGTGCTGTT 0: 1
1: 24
2: 144
3: 797
4: 2679
Right 926897432 2:17709629-17709651 GTGCTGTTCCAGAGGATAAAGGG 0: 1
1: 0
2: 3
3: 13
4: 172
926897425_926897432 30 Left 926897425 2:17709576-17709598 CCTATTCATCCATTAATTCAACA 0: 1
1: 8
2: 26
3: 145
4: 881
Right 926897432 2:17709629-17709651 GTGCTGTTCCAGAGGATAAAGGG 0: 1
1: 0
2: 3
3: 13
4: 172
926897426_926897432 21 Left 926897426 2:17709585-17709607 CCATTAATTCAACACATATTTAG 0: 1
1: 2
2: 26
3: 195
4: 864
Right 926897432 2:17709629-17709651 GTGCTGTTCCAGAGGATAAAGGG 0: 1
1: 0
2: 3
3: 13
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926897432 Original CRISPR GTGCTGTTCCAGAGGATAAA GGG Intronic
901567816 1:10133164-10133186 CTGCTTTGCCAGAGGAGAAAAGG + Intronic
909848908 1:80434774-80434796 GTCCTGTCACAGAGAATAAATGG - Intergenic
910263859 1:85317308-85317330 CTGCTCCTCCAGAGGAGAAAGGG - Intergenic
910830901 1:91462011-91462033 GTGCTGATTCAGAGCATACACGG + Intergenic
911095968 1:94055354-94055376 GTGCTGTTGCATTGGATAAAAGG - Intronic
911406797 1:97451344-97451366 CTACAGTTGCAGAGGATAAAAGG + Intronic
914743340 1:150483149-150483171 GTGCTGATCCTGAGGACAAGTGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917675613 1:177316372-177316394 CTGCTTTCCCAAAGGATAAAAGG + Intergenic
918376983 1:183919008-183919030 ATGCTGTTTCAGAGTATAAAGGG - Intronic
923273807 1:232379791-232379813 GTGCTGTTGCAGTGGTTACATGG - Intergenic
923841341 1:237674719-237674741 TTGCTCTTCCAGAGGATTTAAGG + Exonic
923983821 1:239356869-239356891 GTGCTGTGACAGTGGATACATGG - Intergenic
1064644079 10:17442930-17442952 CTGCTGTTCTAGATTATAAATGG + Intronic
1066467769 10:35668326-35668348 GTGCTGTACCAGAGGATGAATGG - Intergenic
1067186170 10:44029845-44029867 GTGCTGTTTCAGAGGAGGGAGGG + Intergenic
1068828108 10:61462449-61462471 GTGCTCTTACAAAGGAGAAAAGG - Intergenic
1068954789 10:62813140-62813162 GTGCAGCTCCAGTGGACAAAGGG + Exonic
1070114677 10:73517004-73517026 GAGCAGTTCCAGAGGATGCAGGG - Exonic
1070864866 10:79702246-79702268 GTTCTGTCTCAGAGGACAAAAGG + Intergenic
1070878655 10:79840374-79840396 GTTCTGTCTCAGAGGACAAAAGG + Intergenic
1071631760 10:87224463-87224485 GTTCTGTCTCAGAGGACAAAAGG + Intergenic
1071645214 10:87356684-87356706 GTTCTGTCTCAGAGGACAAAAGG + Intergenic
1071996954 10:91158949-91158971 GTGAAGTTCCAGGGGAGAAAGGG - Intergenic
1073727740 10:106253833-106253855 GTGCTGTTGGGGAAGATAAAAGG - Intergenic
1074669938 10:115778871-115778893 GAGCTATTTCAGAGGATAAAGGG + Intronic
1074810147 10:117096370-117096392 GAGCTGCTCCAAAGGATATATGG - Intronic
1074986127 10:118661519-118661541 GTGGTGTTCCTGAGGAAGAAGGG - Intergenic
1076215706 10:128692091-128692113 GTCCTTTTCCAGAGGAGGAAAGG + Intergenic
1076503681 10:130957269-130957291 GTGCGGTCCCAGAGAGTAAAGGG - Intergenic
1076828965 10:132984884-132984906 GTGCTGTTCCAGGTGCTGAAGGG + Intergenic
1077377875 11:2214009-2214031 GTGCTGTAACAGTGGATACAGGG - Intergenic
1078372791 11:10764313-10764335 TTGCTGTTCCATAGGCTGAAAGG - Exonic
1080621715 11:33992338-33992360 TTGCAGTTCTAGAGGATAAATGG + Intergenic
1081091161 11:38867612-38867634 GTGCTGTTCCAGGGTAACAACGG - Intergenic
1081685795 11:45042180-45042202 GTGGTGTGCTAGAGGAGAAAGGG - Intergenic
1083243486 11:61407511-61407533 CTGCTTTTCCAGAGGATACATGG + Intronic
1085598517 11:77832803-77832825 CTGCTGTTACAGAGCACAAATGG - Intronic
1087144851 11:94801069-94801091 GTGCTGTTCTAGGAGAGAAATGG + Intronic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1089198757 11:116710844-116710866 GAGCTGTGCCAGAGGAGAAATGG + Intergenic
1090589400 11:128249271-128249293 CAGATGTTCCAGAGGGTAAAGGG + Intergenic
1091386668 12:100404-100426 GTTATTTTCCAGAGGATAAAGGG - Intronic
1095950404 12:47778603-47778625 CTACTTTTCAAGAGGATAAAAGG - Intronic
1096318223 12:50587860-50587882 GGTCTGTCCCAGAGAATAAAAGG + Intronic
1097119624 12:56721259-56721281 GGGCTGTTCCAGAGGATGACTGG + Exonic
1098205243 12:68102135-68102157 GTGATGGAGCAGAGGATAAAGGG + Intergenic
1100379122 12:94045278-94045300 GTGCTGTTACAGAAAATAAGGGG - Intergenic
1101534421 12:105604366-105604388 ATGCTGATTCAGAGCATAAATGG + Intergenic
1106622036 13:31379786-31379808 GAGCTGTTCCAAAGGCAAAATGG - Intergenic
1112155080 13:96808398-96808420 CTGCCATACCAGAGGATAAAGGG - Intronic
1114841502 14:26267820-26267842 GTGCTGTGACAGAGAATAATGGG + Intergenic
1115372189 14:32629265-32629287 GTTCTTTTCCAAAGGAAAAAAGG - Intronic
1116516145 14:45808649-45808671 GGGCTGTTACTGAGGATAAGTGG - Intergenic
1118284566 14:64459969-64459991 GTGACGTTCCACAGAATAAAAGG + Exonic
1118443143 14:65829769-65829791 GTGAAGTTTCAGAGGATGAAGGG - Intergenic
1118828167 14:69403305-69403327 GTGCTGCTGCAGTTGATAAATGG + Intronic
1120314139 14:82870753-82870775 GTGCTGTTGCAAAAGAAAAATGG - Intergenic
1121745687 14:96288966-96288988 GTGGTGTTTCAGGGGAAAAATGG + Intronic
1123736720 15:23191677-23191699 CTGCTGTCCCAGTGGAAAAAGGG + Intergenic
1123913085 15:24989566-24989588 TTGCTGTTGGAGAGGATAAGAGG + Intergenic
1124287421 15:28414652-28414674 CTGCTGTCCCAGTGGAAAAAGGG + Intergenic
1124287945 15:28420355-28420377 CTGCTGTCCCAGTGGAAAAAGGG + Intergenic
1124295281 15:28496972-28496994 CTGCTGTCCCAGTGGAAAAAGGG - Intergenic
1127235690 15:57048736-57048758 GTGGGTTTCCAGAGGATAATGGG - Intronic
1129611157 15:77058638-77058660 GTACTGTTCTAGATGATACAAGG - Intronic
1132412726 15:101596646-101596668 TTGGTGTTCCAGAGGAAGAAGGG - Intergenic
1133075800 16:3280329-3280351 ATGCAGTTCCAGAGGATCCATGG - Intronic
1133743623 16:8670676-8670698 GGGCACTTCTAGAGGATAAAAGG - Intergenic
1134873954 16:17678572-17678594 GTGTTGTTCAAGAGGAGAAGAGG - Intergenic
1136265321 16:29113713-29113735 GTGCTCTTCAAGAGAAAAAATGG - Intergenic
1137295131 16:47085033-47085055 CTGCTGTCTTAGAGGATAAAAGG + Intronic
1142054126 16:87981645-87981667 GTGCTCTTCAAGAGAAAAAATGG - Intronic
1142473173 17:174594-174616 GTCATGTTCCAGAGGCAAAAGGG + Intronic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1144324923 17:14169695-14169717 GTTCTTTGCCAGAGAATAAAAGG - Intronic
1146641625 17:34546297-34546319 GTGCTATTCAATAAGATAAATGG + Intergenic
1148798109 17:50207111-50207133 GAGCTGCTCCAGGGGAGAAAGGG + Intergenic
1149995215 17:61402534-61402556 GTGGTGTTTCATAGGGTAAAAGG + Intronic
1152994711 18:395830-395852 GTGCTTTTCAAGAGGATGGATGG - Intronic
1153715934 18:7847965-7847987 GAGCTGTTTCAGGGGAGAAATGG + Intronic
1154390445 18:13932129-13932151 GTTATATCCCAGAGGATAAAAGG + Intergenic
1155360668 18:24997427-24997449 GTGTAGTACCAGAAGATAAAGGG - Intergenic
1160193915 18:76737491-76737513 GTGCTGTTCCCAAGGGTCAAGGG + Intergenic
1161084271 19:2327113-2327135 GTGCTGTTTCAGCTGCTAAATGG + Intronic
1164398221 19:27884762-27884784 GTGCTGTTACTGAGGATAAAGGG - Intergenic
1166793709 19:45413731-45413753 GAGCTGTTCCAGAGACTGAAAGG + Exonic
1167030829 19:46958971-46958993 GTGATTCTCCAGAGGAAAAAGGG + Intronic
925342141 2:3145224-3145246 GGGCTGTTCTACAGGATCAAGGG - Intergenic
926897432 2:17709629-17709651 GTGCTGTTCCAGAGGATAAAGGG + Intronic
928601153 2:32904752-32904774 TTTCTGTTATAGAGGATAAAGGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
931918506 2:66986204-66986226 TTTCTGTTCAAGAGGAGAAATGG - Intergenic
935326331 2:101941167-101941189 GTCCTGCTCAAGAGGAAAAAAGG + Intergenic
938365993 2:130734743-130734765 GTGTTCTTCCAGAGGCTCAAAGG - Intergenic
940260797 2:151777540-151777562 CTGCTGTTCCAGATGTTAACAGG + Intergenic
943828098 2:192421906-192421928 GTGCCGTTCGAGATGAGAAACGG - Intergenic
945740946 2:213660542-213660564 TTGCTGTTCCAAAGGCTACAAGG - Intronic
946543543 2:220712351-220712373 GTGCTGTGCTAGAGGACAACTGG + Intergenic
946994630 2:225377324-225377346 GTGCTGTCACAGAGTATAGAGGG - Intergenic
947105666 2:226665283-226665305 GTGCTGTTACAGAGACTGAAAGG - Intergenic
947266046 2:228283049-228283071 GTGCTGTAGCAGATGAGAAAGGG - Intergenic
947875416 2:233464515-233464537 GTTCTGTTTCAGAGGACAACAGG - Intronic
947978550 2:234388167-234388189 CAGCTGTGCCAGAGGAGAAAGGG + Intergenic
948446235 2:238035301-238035323 GTGCTTTTCCAGGGGAGAATGGG + Intronic
1169688174 20:8300479-8300501 GTGCTGTGAGAGAGTATAAATGG - Intronic
1169774593 20:9238607-9238629 GTGATTTTCCAGAGCATAAAAGG + Intronic
1169977893 20:11351328-11351350 GTGCAGTTGCAAAGAATAAAGGG - Intergenic
1170997951 20:21383091-21383113 GTTATCTTCAAGAGGATAAAAGG + Intronic
1171188193 20:23138428-23138450 GAGCTGTCCCTGGGGATAAAGGG - Intergenic
1171211766 20:23322263-23322285 GTTCTGTTCCTAAGGAAAAAGGG + Intergenic
1171295940 20:24017172-24017194 GGGCTGTTCCAGAGGAGTGAAGG - Intergenic
1174740190 20:53005424-53005446 TTCCTGTTCCAGAGGAGAAATGG + Intronic
1175421490 20:58837429-58837451 TTGCTGTTCCACAGGAAAAGTGG + Intergenic
1179001621 21:37465939-37465961 GTGCTGTTACAGATTATGAATGG + Intronic
1179841096 21:44074375-44074397 GAGGTGTTGCAGAGGATAGAAGG + Exonic
1181549886 22:23631775-23631797 GAGGTGTGCCAGAGGGTAAACGG + Intronic
1181798506 22:25327757-25327779 GAGGTGTGCCAGAGGGTAAACGG - Intergenic
1184498476 22:44857699-44857721 GGCCTGCTCCAGAGGAGAAAGGG + Intronic
953836836 3:46353741-46353763 TTCATGTTCCAGAGAATAAAGGG - Exonic
960183135 3:114606681-114606703 GTGCTGCTCCAGAGGTTCAAAGG - Intronic
960934824 3:122892159-122892181 GTGCTGTTCCATTGTAGAAATGG + Intergenic
961424842 3:126836908-126836930 CTGCTCTTCCTGAGGAGAAATGG + Intronic
962503510 3:136020802-136020824 GCTCTGTTTCAGAGGAGAAATGG + Intronic
966243738 3:177782633-177782655 TTGCTATTCCAGAGGGTTAAAGG - Intergenic
966373119 3:179268850-179268872 CTGCTTTTCCAGAGTAAAAAGGG + Intergenic
970292473 4:14589229-14589251 GTACTGTGCCACAGGATAGAAGG + Intergenic
970427740 4:15961377-15961399 GATCTGTCCCAGAGGAGAAAAGG - Intronic
971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG + Intergenic
974727408 4:65813923-65813945 GTGCTGGTTCAGAGCATACACGG - Intergenic
978270307 4:106881509-106881531 GTGATTTTCCACAGGAAAAATGG + Intergenic
979868789 4:125790363-125790385 CTGCTGCCCCAGAAGATAAAGGG + Intergenic
980301398 4:130999227-130999249 GTGCTGTTGCAAAAGAAAAATGG - Intergenic
980405704 4:132352403-132352425 ATGCTGATCCAGAGCATACACGG + Intergenic
980617905 4:135256578-135256600 CTGCTATTCCAGAGGACACAAGG - Intergenic
981206424 4:142046369-142046391 GTGCTGGCCCAGAGGAGAAAGGG + Intronic
982540678 4:156666230-156666252 CTGCTGTTCCAGAGGACAGGAGG + Intergenic
987022999 5:13894278-13894300 GTGCTGAACAACAGGATAAATGG - Intronic
989486196 5:41994973-41994995 GTGCTGATTCAGAGCATACATGG + Intergenic
990270899 5:54137709-54137731 ATATTGTTCCAGATGATAAATGG + Intronic
991135075 5:63173438-63173460 GTGGTGTTGAAGAGGGTAAAGGG + Intergenic
993320011 5:86459958-86459980 GTGCTGATTCAGAGCATACATGG - Intergenic
995054425 5:107743641-107743663 GTTCTGCTGCAGAGGATACAAGG + Intergenic
996018744 5:118569257-118569279 ATGCTGATGCAGAGCATAAACGG - Intergenic
997339007 5:133127967-133127989 GTGCTGGTCTAGAGGCTGAAGGG + Intergenic
998807405 5:145932267-145932289 CTGCCTTCCCAGAGGATAAAAGG + Intergenic
1000146567 5:158458920-158458942 GTGCTGTTTAAAAGGAAAAAAGG + Intergenic
1001777292 5:174338170-174338192 GTCCTTCTCCAGAGGCTAAAAGG + Intergenic
1002319633 5:178367339-178367361 TTGCCGCTCCAGAGGAGAAACGG - Intronic
1002766026 6:239724-239746 GGGCTGTTTCTGAGGATAGAGGG - Intergenic
1004772613 6:18801113-18801135 GGTCTGTTACAGAGAATAAATGG + Intergenic
1007783893 6:44269628-44269650 CTGCTGTGCCAGGGGATACAGGG + Intergenic
1013437492 6:110125439-110125461 GTTATGCTTCAGAGGATAAAAGG - Intronic
1015647393 6:135408372-135408394 ATGCTGTTCCAGATTTTAAAAGG - Intronic
1016845362 6:148563529-148563551 GAGCTATTCCAGAGGACAAAGGG - Intergenic
1018634478 6:165848735-165848757 TTGCTGTTCCAGAGGAACAGTGG + Intronic
1023316966 7:38948092-38948114 TTGCTGTTTCAGAGGTGAAAGGG - Intergenic
1023706217 7:42944325-42944347 GTGTTTTTCCAGAGGTTTAATGG + Intronic
1030607848 7:111657264-111657286 GTGCTGTTACAGGGGAAGAACGG - Intergenic
1031943007 7:127809148-127809170 GTGCTCTGTCACAGGATAAAAGG + Intronic
1033853509 7:145527295-145527317 TTGCAGTCCCAGAGGCTAAATGG + Intergenic
1033879849 7:145867908-145867930 TTGATGTTCCAGAAGATGAAAGG - Intergenic
1039092586 8:33847932-33847954 GTGCTTTAGCAGAGGGTAAATGG + Intergenic
1041968441 8:63708599-63708621 GTGCTGTTGTACAGGAGAAAGGG + Intergenic
1041986371 8:63925856-63925878 ATGCTGATCCAGAGCATACATGG - Intergenic
1043883183 8:85568176-85568198 TTGCTGATCCAGAGGAGGAAGGG + Intergenic
1044758918 8:95496160-95496182 CTGCAGTTCCAGTGGAGAAATGG - Intergenic
1045200770 8:99978518-99978540 GAGCTTTTCCAGAGGCAAAATGG - Intronic
1046496875 8:115025495-115025517 CTGCAGTTACAGAGCATAAATGG + Intergenic
1047588366 8:126299556-126299578 GTGGTTTTCCAGAGGAAAACAGG + Intergenic
1048197307 8:132342400-132342422 GTGCGGTGCCAGAGTAGAAAGGG + Intronic
1048806681 8:138247440-138247462 GTGCTGAGCAAAAGGATAAAAGG - Intronic
1050945034 9:11506093-11506115 GTTCTGCTCTAGAGGATGAAAGG - Intergenic
1051533577 9:18132179-18132201 GTGCTGTCCCCGGGGAAAAAAGG + Intergenic
1054978930 9:71181149-71181171 GTGCTCTTCCTGAGAACAAAGGG + Intronic
1058093487 9:100832406-100832428 GCTGTGTTCCAGAGAATAAAGGG + Intergenic
1062275578 9:135728812-135728834 GAGCTGTTCCAGATTAAAAAGGG - Intronic
1185774117 X:2788456-2788478 ATGCTTTTCCAGATGACAAATGG + Intronic
1186416126 X:9384503-9384525 GTTGTGATCCAGAGGAGAAAAGG - Intergenic
1186601202 X:11039203-11039225 TATCTGTTCCAGATGATAAAAGG + Intergenic
1187000393 X:15170898-15170920 GTGCTTGTCCAGAGGTTAAGAGG + Intergenic
1188988999 X:36794622-36794644 GTGCTTTCTCAGTGGATAAACGG + Intergenic
1190458159 X:50645071-50645093 GTGCTGTTCCAGAGTGTACTGGG - Intronic
1191165938 X:57392407-57392429 GTGACGTTCCACAGAATAAAAGG - Intronic
1195141585 X:101965663-101965685 GTGAACTTTCAGAGGATAAAAGG + Intergenic
1195297366 X:103492263-103492285 GGTGTGTTCCAGAGGACAAAGGG + Intergenic
1195317166 X:103690554-103690576 GTGCTGATTTAGAGGATATAAGG + Intergenic
1198314251 X:135450654-135450676 CTGCTGTTACAGAGAATAATAGG + Intergenic
1200785642 Y:7258081-7258103 GTGCAGTTTCAGGGGATCAATGG + Intergenic