ID: 926897478

View in Genome Browser
Species Human (GRCh38)
Location 2:17710109-17710131
Sequence GGTGCCAAGTAACCAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926897476_926897478 11 Left 926897476 2:17710075-17710097 CCTGACTTTACGTTGGCTGCTGT 0: 1
1: 0
2: 1
3: 6
4: 78
Right 926897478 2:17710109-17710131 GGTGCCAAGTAACCAGAAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926897478 Original CRISPR GGTGCCAAGTAACCAGAAGC AGG Intronic
902970558 1:20045066-20045088 GGTTCCAAATAACCAGAAAATGG - Intronic
903028404 1:20445530-20445552 GCTTCCATGTCACCAGAAGCAGG + Intergenic
903853186 1:26320531-26320553 GATGTCCAGTAACCACAAGCAGG - Intergenic
906455867 1:45996468-45996490 GGTGCCCACTAGCCAGAAGATGG + Intronic
914983880 1:152440270-152440292 GGTGCCAAGCAAGGAGAAGTGGG - Intergenic
915528806 1:156491647-156491669 GCTGCTCAGTAACCACAAGCAGG - Intronic
915632225 1:157161384-157161406 GGTGCCAAGTAAACATTTGCAGG - Intergenic
916207114 1:162325758-162325780 GGTACCAAGTCACCTGAAGATGG - Intronic
921169013 1:212529224-212529246 CATACCAAGTAACCAGAAACTGG + Intergenic
923868384 1:237964278-237964300 GGTGCCAAGCAAGGAGAATCAGG + Intergenic
924399862 1:243667528-243667550 GGTGAGAAGTTATCAGAAGCTGG - Intronic
1066019993 10:31288903-31288925 GGTGACATGTAAAGAGAAGCTGG + Intergenic
1067101612 10:43338557-43338579 GGTGCCAAGATACCAAAAGGAGG + Intergenic
1069419796 10:68236858-68236880 TGTGCCAAGTGACTGGAAGCTGG - Intergenic
1072553596 10:96497488-96497510 GGTTGAAAGCAACCAGAAGCTGG - Intronic
1073053555 10:100684880-100684902 TGGGCAAAGTGACCAGAAGCAGG + Intergenic
1077117798 11:893189-893211 GGGGCCAAGTGGACAGAAGCAGG - Intronic
1078291542 11:10015434-10015456 CGTGAGAAGTCACCAGAAGCTGG - Intronic
1079388177 11:19999094-19999116 GGTGCCAACCAACCAGAATAGGG + Intronic
1082647249 11:55742790-55742812 TGAGCCAACTCACCAGAAGCCGG - Intergenic
1083348793 11:62012809-62012831 AGTTCCAAGAAACAAGAAGCTGG - Intergenic
1086411947 11:86552470-86552492 GGTGGCAAGTTACCAAAGGCAGG - Intronic
1087009674 11:93501459-93501481 AATGCCAAGCCACCAGAAGCTGG - Intronic
1089947484 11:122492371-122492393 GGTTGCAAGCAACCAGATGCCGG + Intergenic
1090444363 11:126750679-126750701 GGTGTCAGGGAACCAGAAGCTGG - Intronic
1093704351 12:22258060-22258082 AGTGAGAAGTAGCCAGAAGCTGG + Intronic
1101469016 12:104977704-104977726 GGTGACCAAGAACCAGAAGCTGG - Intergenic
1102262865 12:111455465-111455487 GGTGCAGTGTAACTAGAAGCTGG - Intronic
1102417196 12:112774103-112774125 GATGCCAAGAAACAAGAAGATGG + Intronic
1103565074 12:121811449-121811471 GGTGCCATGTAGCCAGAAAAAGG + Intronic
1106843770 13:33714707-33714729 GGTGACAAGTAACAAAAAGCAGG + Intergenic
1106906636 13:34416228-34416250 GCTCCCAGGTAACCAGAAGCAGG + Intergenic
1109343454 13:61089730-61089752 GGTTCCAAATAACCAGAAAACGG + Intergenic
1118030542 14:61813392-61813414 GGTGCCAAGATGCCAAAAGCAGG - Intergenic
1118835443 14:69474653-69474675 GGTGCCAAGGAAGGAGAATCTGG - Intergenic
1121351025 14:93173172-93173194 GTTGCTTAGAAACCAGAAGCTGG + Intergenic
1122188706 14:100022685-100022707 GGTGCCAAGGAAACAAAAACAGG - Intronic
1122851837 14:104537692-104537714 GCAGCCAAGTAAACAGAAACAGG + Intronic
1123482959 15:20652206-20652228 GGGGCCTACTAGCCAGAAGCAGG - Intergenic
1124632330 15:31344893-31344915 GGCCGCAAGTAACCAGGAGCAGG + Intronic
1128232116 15:66042697-66042719 GATGCCAGCAAACCAGAAGCTGG - Intronic
1129069659 15:72940098-72940120 TGTTCCAAGGAACCAGAGGCTGG - Intergenic
1129340742 15:74884750-74884772 GGTGCCAAGCAAGGAGAATCAGG + Intergenic
1129925835 15:79363864-79363886 GGTGCCAAGCAAGGAGAATCGGG + Intronic
1131185637 15:90271665-90271687 GTTGCCAAGTGGTCAGAAGCTGG + Exonic
1132087980 15:98923439-98923461 GATGCTGAGTAAGCAGAAGCAGG - Intronic
1134293797 16:12926619-12926641 GGTGCCATGGAGCCAGAAGGAGG + Intronic
1134904407 16:17967710-17967732 ATTGCAAAGTAACCAGAATCTGG - Intergenic
1135672948 16:24390558-24390580 GGTGCCAAGCAAGGAGAATCGGG - Intergenic
1135848830 16:25944034-25944056 GGAGGAAAGTAACAAGAAGCAGG - Intronic
1136482534 16:30551467-30551489 TGTGCCAAGAAACAAGGAGCTGG + Intronic
1137858630 16:51822385-51822407 TGTGCCAGGTAACATGAAGCAGG + Intergenic
1138149069 16:54638249-54638271 GGTGCCAAGAAACCAAGAGATGG - Intergenic
1140647578 16:77049816-77049838 TGTCACAAGTAACCAAAAGCAGG + Intergenic
1141163996 16:81648057-81648079 GAGGCCAGGTAACCAGAAGGCGG - Intronic
1144061786 17:11589480-11589502 GGTGCCAAGCAAGCAGAACCAGG - Intergenic
1145027855 17:19482306-19482328 GGTGCCAAATAAGGAGAATCCGG - Intergenic
1147383577 17:40069639-40069661 GTAGCCAAGAAAGCAGAAGCAGG - Intronic
1152021970 17:77784551-77784573 GGTGCCAAGCAAGGAGAATCAGG + Intergenic
1153020665 18:626056-626078 AGAGTCAAGTAAACAGAAGCTGG + Intronic
1157679570 18:49594012-49594034 GGTTTCAAGTAACTAGAAGGAGG - Exonic
1163627068 19:18396367-18396389 GATGCCGAGTGGCCAGAAGCCGG - Exonic
1164630339 19:29757815-29757837 GGTGCCAGGTACCCAGCAGGTGG - Intergenic
926124038 2:10260504-10260526 GGAGCCCAGGAACTAGAAGCCGG - Intergenic
926897478 2:17710109-17710131 GGTGCCAAGTAACCAGAAGCAGG + Intronic
932495018 2:72141969-72141991 GGTGGGGAGTCACCAGAAGCTGG - Intronic
936585211 2:113751245-113751267 TGTGCCAAGTAACAAGAGACGGG + Intronic
941494923 2:166188064-166188086 GGTCCCAAGGAGACAGAAGCAGG + Intergenic
943418895 2:187641847-187641869 GGTGCAAGGAAACAAGAAGCTGG - Intergenic
943504367 2:188734826-188734848 GGTGGCAAGTAACAGGAAACAGG + Exonic
1174482757 20:50842801-50842823 GGGGGCAAGTCACCAGAAACAGG - Intronic
1174523968 20:51156644-51156666 GGTGACAAGTGACAAGATGCAGG + Intergenic
1176903886 21:14476841-14476863 GGAGTAAAGTAACCATAAGCAGG - Intergenic
1180733539 22:18000035-18000057 GCGGCCAGGTAACCAGAAGGCGG + Intronic
1184449667 22:44575548-44575570 GGTGCCCAGCACCCAGCAGCAGG + Intergenic
949864223 3:8533921-8533943 GGTCCCTAGCAACCAGAAGACGG - Intronic
952656157 3:35788111-35788133 GGAGCCAAGAAAACAGAACCAGG + Intronic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
954223721 3:49169852-49169874 GGTGACAAGTAACAAGGAGGTGG + Intergenic
957985563 3:87570731-87570753 GGTTCCAAATAACCAGAAAATGG + Intergenic
959634998 3:108555922-108555944 GGTGCCAAGTAAGGAGGAGCAGG - Intronic
962015890 3:131440566-131440588 GGTGCCAAGCAAGGAGAATCAGG + Intergenic
962492532 3:135908341-135908363 GGAGCCAAGTGGCCTGAAGCGGG - Intergenic
962701011 3:137999665-137999687 GGTGACAAGGAACCAGACTCAGG + Intronic
964080031 3:152743297-152743319 GGTGAGAAGTAGCCATAAGCTGG - Intergenic
964155513 3:153580795-153580817 GGTATCAAGAAACCTGAAGCTGG + Intergenic
965077759 3:164001695-164001717 GTTGCCAAGTGATCAGAAGCTGG - Intergenic
965105357 3:164346460-164346482 GGTTCCAAATAACCAGAAAACGG - Intergenic
968229731 3:196998297-196998319 GGTGCTAACAAGCCAGAAGCTGG - Intronic
972450726 4:39195576-39195598 GATGCCAAGTGACCAGAGGTTGG - Intronic
973954369 4:56048908-56048930 GGTGCCCAGAAACCAGGAGCGGG - Intergenic
982627799 4:157789201-157789223 GGTGCCAAGAAACCATCAGAGGG + Intergenic
983452207 4:167924301-167924323 GGTTCCAAGTAGCCAGAAAATGG + Intergenic
988972600 5:36484506-36484528 GATGCCAAGTGACCAGAGTCGGG - Intergenic
993406102 5:87513278-87513300 GCTGCCAAGTAAAGAGAAACTGG + Intergenic
993820258 5:92605712-92605734 GTTGCGAAGTAAGCAGAAGTTGG + Intergenic
999315141 5:150578849-150578871 GGTGCCAAGTATGCAGAAGAGGG + Intergenic
999896173 5:156036243-156036265 GGTGCCAAGCAAGGAGAATCAGG + Intronic
1001101784 5:168820265-168820287 GGTGCCAGGTGAACAGAAGAAGG - Intronic
1002849476 6:980750-980772 TGTGCCAAGTACTCATAAGCAGG - Intergenic
1004225112 6:13777920-13777942 GGTGCCAAGCAAGGAGAATCAGG - Intergenic
1006732212 6:36244879-36244901 GGTGCCAAGCAAGGAGAATCGGG + Intronic
1006914332 6:37584913-37584935 GGAGCCACGTACCCAGCAGCCGG + Intergenic
1009784744 6:68320782-68320804 GGTGGTAAGTATCCAGAAGTGGG + Intergenic
1010054623 6:71551057-71551079 GCTGCCAAGTGATCAGAAGCTGG - Intergenic
1013673807 6:112434788-112434810 GGTGAAAAGTAGCCAGAATCCGG - Intergenic
1015762345 6:136677866-136677888 GGTGCTCAGTAAGCAGAGGCAGG - Intronic
1016021971 6:139245554-139245576 GGTGCCAAGCTGCCTGAAGCTGG + Intronic
1016519924 6:144935828-144935850 GGGGCCAAGCAACAAAAAGCAGG + Intergenic
1016553499 6:145309230-145309252 GGTGCCAAGCAAGGAGAATCGGG - Intergenic
1018212511 6:161496022-161496044 TGTGCCAAGTGCCCAGAAGATGG - Intronic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1019688153 7:2393948-2393970 GTTGCCAAGTGAGCAGAAGCTGG - Intergenic
1019707021 7:2501798-2501820 GGAGGCAGGTAAGCAGAAGCTGG - Intergenic
1022589542 7:31648470-31648492 GTTTCCAAATAACCAGAAGATGG + Intronic
1025095322 7:56091782-56091804 GGTGCCTGGTTACCAGAAGAAGG + Intronic
1025101847 7:56142206-56142228 GGTGCCAAGCAAGGAGAAGCAGG + Intergenic
1028024032 7:85814032-85814054 GGTGCCAAGGAAATATAAGCAGG - Intergenic
1028077917 7:86537485-86537507 GGTGCCAAGCAAAGAGAATCGGG + Intergenic
1029170132 7:98624659-98624681 GGTGACATGAAACCAGCAGCAGG - Intronic
1030097009 7:105909448-105909470 GGTGGGAAGTAACCAGAATTTGG - Intronic
1030319937 7:108155561-108155583 GGTACCAAGGGAACAGAAGCAGG - Intronic
1033977703 7:147122803-147122825 GGTGCCAAGGAACATGAAGGTGG - Intronic
1036604844 8:10295692-10295714 GGTGCCAAGTGACCACAGGCTGG - Intronic
1038235414 8:25748280-25748302 GTTGCTAAGTAAACAGAGGCTGG + Intergenic
1038327747 8:26585443-26585465 GGTGCCAAGAAAGCTGAAACAGG - Intronic
1038688798 8:29742564-29742586 CCTGCCAAGAAACCATAAGCCGG + Intergenic
1039116090 8:34092751-34092773 GGTGCCAAGCAAGGAGAACCAGG + Intergenic
1039142823 8:34412310-34412332 GGTGCCAACTGACCAGGATCAGG - Intergenic
1040352931 8:46586792-46586814 TGTGCCAACTCCCCAGAAGCTGG + Intergenic
1040973117 8:53159081-53159103 GGTGCCAAGAAAACAGAATGGGG - Intergenic
1042358433 8:67855023-67855045 GGTGCCAAGTAACAACAGGATGG - Intergenic
1042364243 8:67918223-67918245 TATGCTAAGTAACCAGATGCTGG - Intergenic
1046220076 8:111202117-111202139 AGTGAAAAGTAACCAGGAGCTGG + Intergenic
1046791270 8:118324720-118324742 GGGCCAAAGTAAACAGAAGCAGG + Intronic
1047542843 8:125787111-125787133 GGTCCCAAGAAAGCAAAAGCAGG - Intergenic
1048508378 8:135041177-135041199 GCTGCCAAATAACCAGAACTGGG + Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049734771 8:144199154-144199176 GGTGATGAGTAACCAGAAGGAGG + Exonic
1056008062 9:82295101-82295123 TGTGCCAATTAAGCAGAAGGTGG + Intergenic
1056729974 9:89157063-89157085 GGTGCCAAGTAAGGAGAATTGGG - Intronic
1056899946 9:90588879-90588901 GGTGACAAGCAAGGAGAAGCAGG - Intergenic
1059603614 9:115808891-115808913 GGGGCCAAGGAGGCAGAAGCAGG + Intergenic
1059735145 9:117093009-117093031 GGTGCAAAGGAACCTGAAGCTGG + Intronic
1060448878 9:123718324-123718346 GTTGCCAAGCAACCAAAAGAAGG + Intronic
1061276565 9:129572245-129572267 GGTGCCATGTCCCCAGAAGCTGG + Intergenic
1186055380 X:5644168-5644190 GGTGCCAAGTGAGGAGAATCGGG + Intergenic
1192286005 X:69736664-69736686 ACTGCCAAGTAACCAAAAACAGG - Intronic