ID: 926899546

View in Genome Browser
Species Human (GRCh38)
Location 2:17735592-17735614
Sequence GGTTGGTATTAGGAAGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926899540_926899546 -8 Left 926899540 2:17735577-17735599 CCCCAAGGCTACCAGGGTTGGTA 0: 1
1: 0
2: 1
3: 6
4: 74
Right 926899546 2:17735592-17735614 GGTTGGTATTAGGAAGGCCAAGG 0: 1
1: 0
2: 1
3: 7
4: 120
926899541_926899546 -9 Left 926899541 2:17735578-17735600 CCCAAGGCTACCAGGGTTGGTAT 0: 1
1: 0
2: 0
3: 7
4: 90
Right 926899546 2:17735592-17735614 GGTTGGTATTAGGAAGGCCAAGG 0: 1
1: 0
2: 1
3: 7
4: 120
926899535_926899546 28 Left 926899535 2:17735541-17735563 CCACAGCTGATGTCAAAAATTAG 0: 1
1: 0
2: 0
3: 7
4: 153
Right 926899546 2:17735592-17735614 GGTTGGTATTAGGAAGGCCAAGG 0: 1
1: 0
2: 1
3: 7
4: 120
926899542_926899546 -10 Left 926899542 2:17735579-17735601 CCAAGGCTACCAGGGTTGGTATT 0: 1
1: 0
2: 0
3: 7
4: 110
Right 926899546 2:17735592-17735614 GGTTGGTATTAGGAAGGCCAAGG 0: 1
1: 0
2: 1
3: 7
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926899546 Original CRISPR GGTTGGTATTAGGAAGGCCA AGG Intronic
901333775 1:8431026-8431048 AGTTGGTATTTGGAAGACAAAGG - Intronic
903116550 1:21183139-21183161 CTTTGGGATTAGGGAGGCCAAGG + Intergenic
903864791 1:26390133-26390155 GGTTAGTATTGAGAAGGTCAGGG + Intergenic
904406990 1:30297900-30297922 GGTTGGTTTGAGGTTGGCCAGGG - Intergenic
905285141 1:36874472-36874494 GTCTGGTATTAGGAAGCACAGGG - Intronic
910998911 1:93141099-93141121 GGTTGGACTTTGGAGGGCCACGG - Intergenic
911053854 1:93694588-93694610 GGTTGATATTAAGAAGGCATAGG - Intronic
911258582 1:95661170-95661192 GTTTACTATTGGGAAGGCCATGG - Intergenic
912088673 1:106042888-106042910 GCTTGATGTTAGGAAGGCCATGG - Intergenic
912521763 1:110250550-110250572 GGTTGGTGTAAGGAAGGGCCAGG + Intronic
913127068 1:115801743-115801765 GCTTGTTATTAGTAAGGCTATGG + Intergenic
914829011 1:151157139-151157161 GCTGGGTAACAGGAAGGCCAAGG + Intronic
915703392 1:157819656-157819678 CGTTGGTAGTAAGAAGGGCAAGG + Intronic
918394111 1:184096408-184096430 GGTTGGTTTTAGGAATCACAGGG + Intergenic
918424535 1:184394965-184394987 GGTGGGTGTTGGGGAGGCCATGG - Intronic
1067064744 10:43097361-43097383 GGTTCTTATTGGGAAGACCAGGG + Intronic
1068124306 10:52819150-52819172 GGTTGTTATCAGGAAGGTGATGG + Intergenic
1068403876 10:56564804-56564826 GTTTGGTACTAAAAAGGCCAAGG + Intergenic
1069834007 10:71297320-71297342 AGTAGGTTTTAGGAAGGGCAAGG + Intronic
1069852541 10:71419382-71419404 GGCTGGTATGAGAAAGGCCCTGG + Intronic
1069903133 10:71717256-71717278 GCTTGGTGGTGGGAAGGCCAAGG + Intronic
1070734568 10:78854733-78854755 GGTAGGTAAAAGGGAGGCCAGGG - Intergenic
1075126263 10:119702258-119702280 GGATGGGATGAGAAAGGCCAGGG - Intergenic
1075393574 10:122111259-122111281 GGTTGGCAAAAGGAAGGCCCCGG - Intronic
1077351843 11:2096745-2096767 GGTAGGTCTAAGGCAGGCCAGGG - Intergenic
1080672953 11:34398113-34398135 AGTTGGAATTAGAAAGTCCATGG - Intergenic
1083423143 11:62567486-62567508 GGTTGGTATTGGGAAAGGCCTGG + Exonic
1085305843 11:75485780-75485802 GGTTGGTATCAGGAAAGCATAGG + Intronic
1090668539 11:128930692-128930714 GGCTGGGGTTAGGGAGGCCAGGG + Intergenic
1091916203 12:4273089-4273111 GGTGGGTATTAGGAAGGAAGGGG - Intergenic
1101719983 12:107342707-107342729 GCTTGGAATTAGGAATGACAGGG - Intronic
1103588169 12:121971460-121971482 GGTTGGGATTATTACGGCCATGG - Intronic
1104411843 12:128564805-128564827 TGCTGATATTAGGAAAGCCAGGG + Intronic
1106715055 13:32379397-32379419 GTTGGAAATTAGGAAGGCCATGG + Exonic
1112462061 13:99611614-99611636 GTTTGGTATTAGGATGGTGATGG + Intronic
1121107690 14:91291872-91291894 TGTTTGTATGAGGAAGGCCAAGG - Intronic
1124051242 15:26199046-26199068 GGTGGGTTGTAGGAGGGCCACGG + Intergenic
1125798931 15:42427223-42427245 GATTGGTATTAGCAAAGGCAGGG - Intronic
1126790662 15:52218338-52218360 GGTTGGCTTTGGGAAGGCCTTGG - Intronic
1127756978 15:62102371-62102393 GGTTGGTTCTAGAATGGCCATGG - Intergenic
1128189998 15:65683887-65683909 GCCTGGTGTTAGGAAGGCAATGG - Intronic
1128977851 15:72166602-72166624 GCTTGGGAGCAGGAAGGCCAGGG - Intronic
1131177436 15:90218985-90219007 GGGAGGTATTTGGGAGGCCAGGG + Intronic
1137449149 16:48554789-48554811 GGTTGGAATTAGGAGAGCCTGGG - Intronic
1139114365 16:63931592-63931614 GGATGGTACTAGTAAAGCCATGG - Intergenic
1140849418 16:78920825-78920847 GGCTGTTGTGAGGAAGGCCAGGG + Intronic
1141191874 16:81830968-81830990 GGTTGGTTGTAGGAAGAGCAAGG - Intronic
1141606736 16:85158347-85158369 GGTGCCTCTTAGGAAGGCCAAGG + Intergenic
1141631402 16:85290001-85290023 GGTGGGTGTTAAGAAGGCCGGGG + Intergenic
1141749876 16:85951317-85951339 GGTGGGTAGTGGGAAGGCGAAGG - Intergenic
1143776947 17:9205840-9205862 GGGTGGTATTAGGACGGCCATGG - Intronic
1146666895 17:34711212-34711234 GGTTGGAATGAGGAAGGGAATGG - Intergenic
1147967790 17:44202839-44202861 GTTTGGTATGAGGATGGCCATGG - Intergenic
1149737502 17:59009744-59009766 GGTTAGAAATTGGAAGGCCAGGG - Intronic
1203162211 17_GL000205v2_random:62971-62993 GGTTGGAATCAGGAACGCCAGGG + Intergenic
1153438269 18:5089411-5089433 GGTTTTTAATAGGAAGGCTATGG - Intergenic
1153736069 18:8069213-8069235 GTTTGGAAGTAGGAAGGTCAGGG + Intronic
1156036314 18:32770909-32770931 GGTTGGTTTTAGGAAAGTGAGGG - Intronic
1158201522 18:54947047-54947069 GGTTGGTATAAAGAAACCCAAGG + Intronic
1159508838 18:69369566-69369588 GGATGGTTTTGGGAAGGCAAAGG + Intergenic
1162043019 19:7981808-7981830 GGTGAGGATGAGGAAGGCCACGG + Intronic
1163552717 19:17974423-17974445 GGTGGGTATGCAGAAGGCCAGGG - Intronic
1167530433 19:50012573-50012595 GGTTAGCATTAGGAAAGGCAGGG + Intronic
926116913 2:10219118-10219140 GTTTGGGGTTAGGAAGGCCTTGG + Intergenic
926583121 2:14654078-14654100 GGAAGCTATTAGGAAAGCCAAGG - Intergenic
926751375 2:16201229-16201251 GGTTGGTGATAGGAAGGCAGTGG + Intergenic
926899546 2:17735592-17735614 GGTTGGTATTAGGAAGGCCAAGG + Intronic
929892378 2:45929054-45929076 GGTTTGTATTTGGCATGCCAAGG - Intronic
930608232 2:53514364-53514386 GGTTGAGATTAGGAAGGAGAGGG - Intergenic
941008455 2:160270760-160270782 GGCTGGAATGAGGAAAGCCAGGG - Intronic
941467322 2:165843692-165843714 GGTAGGCATGAGGATGGCCAAGG - Intergenic
942330889 2:174822776-174822798 AGTTGGGATGAAGAAGGCCATGG - Intronic
1168978608 20:1986521-1986543 TGTTGGTATTAGGAGAGCCCGGG - Intronic
1170025882 20:11889930-11889952 GGTTGGTATCAGGAATGGAAAGG - Intergenic
1170870664 20:20203071-20203093 GGCAGGAATTAGGAAGGCCTTGG - Intronic
1172101776 20:32488178-32488200 AGTGGGTCTTTGGAAGGCCAAGG - Intronic
1172114402 20:32565019-32565041 GCTTGGGATTAGGCAGGCCCGGG + Intronic
1173672349 20:44807555-44807577 GACAGGTATTAAGAAGGCCAGGG + Intronic
1173872795 20:46352272-46352294 GGTTGGCATTGGGCTGGCCAAGG - Intronic
1181369695 22:22406121-22406143 GGTAGGCAGTATGAAGGCCATGG + Intergenic
1203234236 22_KI270731v1_random:140960-140982 GGGTAGCCTTAGGAAGGCCAAGG - Intergenic
950265398 3:11569427-11569449 TGTTGGTTTTTGGGAGGCCAGGG - Intronic
951419713 3:22470092-22470114 AGCTGGTCTTAGGGAGGCCATGG + Intergenic
952801742 3:37299137-37299159 GTTTGGTGTTATGTAGGCCAGGG - Intronic
955539414 3:59958615-59958637 GGGTTGTATTAAGAAGCCCAAGG + Intronic
955596819 3:60600150-60600172 TGTGGATATTGGGAAGGCCATGG - Intronic
962565032 3:136649185-136649207 GGTTGTTAATTGAAAGGCCAGGG + Intronic
963414686 3:144979702-144979724 GATTAGGACTAGGAAGGCCATGG + Intergenic
968312669 3:197696932-197696954 GGTGAGTACTAGGAAGGCCAGGG - Exonic
971225948 4:24751747-24751769 AGTTGGTGTTAGGCAGGCCAAGG - Intergenic
972254102 4:37335000-37335022 GTTTGGTATTAGGGAGGAAAAGG - Intronic
975915864 4:79325100-79325122 GGATGGAATTGGGCAGGCCAAGG + Intronic
991933504 5:71780086-71780108 GGTTGGTATTTAGGAGGACAGGG + Intergenic
997646238 5:135483886-135483908 GGTAAGGATTATGAAGGCCAGGG - Intergenic
998166305 5:139846398-139846420 GGTTGGTAATAGCACAGCCAAGG - Intergenic
998764174 5:145466794-145466816 GGTTGGGGTTAAGAAGGCCTGGG - Intergenic
998919521 5:147052561-147052583 GGTTGGAATTAACAAGGCAATGG + Intronic
1001055051 5:168442310-168442332 GGTTGTTATGAGGATGGGCACGG + Intronic
1001272771 5:170328010-170328032 GCTTGATATGAGGAAGACCAAGG - Intergenic
1001476650 5:172055313-172055335 GGTGGCTATTTGGAAGGCCGAGG - Intronic
1002442139 5:179270011-179270033 GGATGTTATTAGGAGGGGCAAGG - Intronic
1006155132 6:32009696-32009718 GGGTGGCATTGGGAAGCCCAGGG - Intergenic
1006161442 6:32042430-32042452 GGGTGGCATTGGGAAGCCCAGGG - Intronic
1006847625 6:37073772-37073794 GGATGGTGTTAGGCAGGCCTGGG + Intergenic
1007801496 6:44397673-44397695 GATTGGTATTGGGAAGGCACTGG + Intronic
1011761350 6:90569318-90569340 GGTTGGGATTACTAAGGCAATGG - Intronic
1013796537 6:113895253-113895275 GTTTGGTGATAGGAAGGACAGGG + Intergenic
1014244486 6:119053082-119053104 GGTTTGTGTTAGGAAGCACAGGG - Intronic
1017646928 6:156547841-156547863 GGTTAGCATTAGGAATGCTATGG + Intergenic
1022476485 7:30713968-30713990 AGATGGTATTGGGAGGGCCAAGG - Intronic
1033266467 7:139891365-139891387 GGATGTTATTGGGATGGCCATGG - Intronic
1034121272 7:148630065-148630087 GGTTGCAATTAGGTATGCCAGGG + Intergenic
1036991584 8:13603758-13603780 GGTTGCTGTAAGGAAAGCCATGG + Intergenic
1037626887 8:20615895-20615917 GCTTGGTATTAGCAAGGGAAAGG - Intergenic
1040632672 8:49234201-49234223 GTTAGGGATTAGGAAGGTCATGG + Intergenic
1041741348 8:61160426-61160448 GGCAGGCATTAGGAAGGCCCTGG - Intronic
1050546300 9:6712212-6712234 GGTTGGTATTTAGAAATCCAAGG + Intergenic
1052741436 9:32396503-32396525 GGTGGGTCTAAGGAAGGCCAAGG - Intronic
1053730847 9:41055374-41055396 GGTTCTTATTAGGTAGGCCTTGG - Intergenic
1055885666 9:81060589-81060611 GCTTGGTACTATAAAGGCCAGGG + Intergenic
1056765257 9:89441216-89441238 GGTTGGTATTCGTAAGGTCTGGG - Intronic
1188041315 X:25372560-25372582 GGTTGGTATGAGGACGGGGATGG - Intergenic
1190290769 X:48990759-48990781 GGTTGTTGTTAGCAAGGACAAGG + Intronic
1196439234 X:115703353-115703375 GGTTGGTATTGGGAAAGGCCTGG - Intergenic
1198502617 X:137267016-137267038 ATTTGGTAGTAGGAAGGTCAGGG + Intergenic
1200356632 X:155559279-155559301 GGTTAGTATTTGGAAGGATAAGG - Intronic
1200391771 X:155952753-155952775 GGTTAGTATTAGGATGGGCTTGG + Intergenic
1200456246 Y:3397452-3397474 TGTTGGTATTAGGGAGACCCTGG + Intergenic
1201432322 Y:13915629-13915651 GATTGGTAATAGGAAAGACATGG + Intergenic