ID: 926901149

View in Genome Browser
Species Human (GRCh38)
Location 2:17753529-17753551
Sequence GACCCCCAGCCACCCGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 214}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926901149_926901160 4 Left 926901149 2:17753529-17753551 CCTCTCCCGGGTGGCTGGGGGTC 0: 1
1: 0
2: 2
3: 23
4: 214
Right 926901160 2:17753556-17753578 GCCAAGGGGGCAGCGGGCGGAGG 0: 1
1: 0
2: 2
3: 56
4: 535
926901149_926901162 15 Left 926901149 2:17753529-17753551 CCTCTCCCGGGTGGCTGGGGGTC 0: 1
1: 0
2: 2
3: 23
4: 214
Right 926901162 2:17753567-17753589 AGCGGGCGGAGGATGAACCCCGG 0: 1
1: 0
2: 2
3: 6
4: 151
926901149_926901163 22 Left 926901149 2:17753529-17753551 CCTCTCCCGGGTGGCTGGGGGTC 0: 1
1: 0
2: 2
3: 23
4: 214
Right 926901163 2:17753574-17753596 GGAGGATGAACCCCGGAGCAAGG 0: 1
1: 0
2: 0
3: 21
4: 157
926901149_926901157 -2 Left 926901149 2:17753529-17753551 CCTCTCCCGGGTGGCTGGGGGTC 0: 1
1: 0
2: 2
3: 23
4: 214
Right 926901157 2:17753550-17753572 TCGCCAGCCAAGGGGGCAGCGGG 0: 1
1: 0
2: 0
3: 17
4: 194
926901149_926901156 -3 Left 926901149 2:17753529-17753551 CCTCTCCCGGGTGGCTGGGGGTC 0: 1
1: 0
2: 2
3: 23
4: 214
Right 926901156 2:17753549-17753571 GTCGCCAGCCAAGGGGGCAGCGG 0: 1
1: 0
2: 0
3: 31
4: 684
926901149_926901155 -9 Left 926901149 2:17753529-17753551 CCTCTCCCGGGTGGCTGGGGGTC 0: 1
1: 0
2: 2
3: 23
4: 214
Right 926901155 2:17753543-17753565 CTGGGGGTCGCCAGCCAAGGGGG 0: 1
1: 0
2: 0
3: 15
4: 209
926901149_926901159 1 Left 926901149 2:17753529-17753551 CCTCTCCCGGGTGGCTGGGGGTC 0: 1
1: 0
2: 2
3: 23
4: 214
Right 926901159 2:17753553-17753575 CCAGCCAAGGGGGCAGCGGGCGG 0: 1
1: 0
2: 2
3: 46
4: 410
926901149_926901164 23 Left 926901149 2:17753529-17753551 CCTCTCCCGGGTGGCTGGGGGTC 0: 1
1: 0
2: 2
3: 23
4: 214
Right 926901164 2:17753575-17753597 GAGGATGAACCCCGGAGCAAGGG 0: 1
1: 0
2: 0
3: 11
4: 112
926901149_926901154 -10 Left 926901149 2:17753529-17753551 CCTCTCCCGGGTGGCTGGGGGTC 0: 1
1: 0
2: 2
3: 23
4: 214
Right 926901154 2:17753542-17753564 GCTGGGGGTCGCCAGCCAAGGGG 0: 1
1: 0
2: 0
3: 10
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926901149 Original CRISPR GACCCCCAGCCACCCGGGAG AGG (reversed) Intronic
900340106 1:2184312-2184334 GATCCCCAGCCACCCATGCGAGG - Intronic
900414141 1:2527430-2527452 GACCCCGGGTTACCCGGGAGGGG - Intergenic
900498068 1:2985388-2985410 GCCCCTCAGCCTCCGGGGAGAGG + Intergenic
900505731 1:3029121-3029143 GAGCCCCTGTCACCTGGGAGGGG + Intergenic
900505756 1:3029185-3029207 GAGCCCCTGTCACCTGGGAGGGG + Intergenic
900505780 1:3029249-3029271 GAGCCCCTGTCACCTGGGAGGGG + Intergenic
900505803 1:3029313-3029335 GAGCCCCTGTCACCTGGGAGGGG + Intergenic
900505848 1:3029441-3029463 GAGCCCCTGTCACCTGGGAGGGG + Intergenic
900762704 1:4483567-4483589 CACCTCCAGCCCCCCGGGACTGG - Intergenic
900876672 1:5347827-5347849 GACCCCCAGCCTCCCTAGGGAGG + Intergenic
902336447 1:15757611-15757633 GCCCCAGAGCCACCCTGGAGGGG + Intronic
904701695 1:32361900-32361922 GGCGCCCGGCGACCCGGGAGAGG - Intronic
904707630 1:32403367-32403389 TAACCCCAGCTACTCGGGAGGGG - Intergenic
906492889 1:46281786-46281808 GAGTCCCAGCTAGCCGGGAGCGG + Intronic
906712450 1:47941001-47941023 GACAGCCAGCCAGTCGGGAGTGG - Intronic
912913623 1:113789161-113789183 TACCCCCAACCTCCAGGGAGGGG + Intronic
915062698 1:153199387-153199409 AACACCCAGCCAGCAGGGAGAGG + Intergenic
916164686 1:161955467-161955489 GATGCCCAGCCACCCAGGGGAGG + Intronic
917305492 1:173619706-173619728 TAATCCCAGCCACTCGGGAGGGG + Intronic
920269431 1:204752147-204752169 GAACCCCAGCCTCCTGGGTGGGG + Intergenic
921157437 1:212449491-212449513 GACCCCCAGCCATCTGCAAGGGG - Intergenic
921930212 1:220748584-220748606 GACCCCGAGCCACCTGGGCCAGG - Exonic
921934868 1:220786997-220787019 AACCCCGAGCCACCCGGGCCGGG - Exonic
1062919304 10:1267159-1267181 CACCCACACCTACCCGGGAGGGG - Intronic
1064392466 10:14953857-14953879 AGCCCCCAGCGCCCCGGGAGCGG + Intronic
1066688422 10:38003090-38003112 CACCCCCAGCCACTCTGGGGTGG + Intergenic
1067159007 10:43807155-43807177 GAGACCCAGCCACGCCGGAGAGG + Intergenic
1068518372 10:58051646-58051668 GACCACCAGCCTCCAGGAAGGGG + Intergenic
1068859698 10:61834944-61834966 GGCCCCCATCCACCCAGGAAGGG + Intergenic
1069010203 10:63363804-63363826 TAGTCCCAGCTACCCGGGAGAGG - Intronic
1069749289 10:70735318-70735340 GGCCCCCAACCACCTGGCAGAGG - Intronic
1071023447 10:81084152-81084174 GACACCCACCCACCTGGGATTGG - Intergenic
1076111744 10:127865074-127865096 CACCCCCAGCCTCCAGAGAGGGG + Intergenic
1076298133 10:129403275-129403297 GAACCCCAGCCAAGTGGGAGAGG + Intergenic
1076529263 10:131133709-131133731 GACCAGCAGCCACACAGGAGGGG + Intronic
1076758395 10:132587316-132587338 GACCCCCTGCCACCCCTGTGAGG - Intronic
1077499925 11:2904712-2904734 GACCCCCAGCTCCGAGGGAGTGG - Intronic
1079732857 11:23957561-23957583 TACCCCCAGCCACATAGGAGTGG + Intergenic
1080445424 11:32333591-32333613 CGCCCCCAGCCACGCAGGAGCGG + Intergenic
1084312521 11:68325182-68325204 GGACCCCAGCCCTCCGGGAGAGG - Intronic
1085350091 11:75792677-75792699 GACCACCAGCCACCTGGAAGAGG + Intronic
1087755205 11:102047707-102047729 AACCCCGAACCACCCGGGAAGGG + Intronic
1087923702 11:103895610-103895632 GACCCCCAGCCAGCCTGGAGAGG - Intergenic
1088598337 11:111455964-111455986 CACCCCCAGACACCCAGCAGGGG + Intronic
1090325166 11:125879734-125879756 ATCTCCCAGCCACCAGGGAGGGG - Intergenic
1090854027 11:130596432-130596454 AACCCCCAGCCACCCTGCCGGGG + Intergenic
1092230433 12:6772936-6772958 GACCTCCAGCCCCACAGGAGGGG + Intronic
1094443785 12:30507770-30507792 AACCCCCAGCCTCCTGGGAGGGG - Intergenic
1095417622 12:41993651-41993673 GACCTCCAGCCACACAGGAGGGG + Intergenic
1096071316 12:48776904-48776926 GACTCCCAGCCAGCCGAGATGGG - Intronic
1096122118 12:49094873-49094895 CACCCCCTCCCACCCGGGCGGGG + Intergenic
1096240976 12:49960260-49960282 CACCCCCAGGATCCCGGGAGAGG - Intergenic
1097261060 12:57720545-57720567 GGCCCCCAGCCCTCCTGGAGTGG + Intronic
1097890580 12:64773423-64773445 GAGCCCAAGCCAACTGGGAGAGG + Intergenic
1104860973 12:131923346-131923368 GACCCCCAGCCTGGCGGGAGAGG - Intergenic
1106534211 13:30624496-30624518 TAGCCCCAGCTACCCGGGAGGGG + Intronic
1107057573 13:36123936-36123958 GACTCCCATCCACCAAGGAGAGG - Intronic
1113853463 13:113431084-113431106 GGCCCACAGCCACCTAGGAGAGG + Intronic
1114671047 14:24411276-24411298 GACCCTCTGCCACCCCAGAGTGG + Intronic
1117246382 14:53890588-53890610 GACCCCCACCCAGGAGGGAGAGG - Intergenic
1119325887 14:73759430-73759452 GGCCCCCGCCCACCCGGGCGCGG - Intronic
1119727243 14:76928918-76928940 CTCCCCCTGCCACCAGGGAGAGG + Intergenic
1120850163 14:89162701-89162723 GAGCCCCAGCGACACGGAAGAGG - Exonic
1120890182 14:89484692-89484714 GATCACCAGCCACCAGGAAGCGG - Intronic
1122113289 14:99515892-99515914 GCCCCCCACCCCCCCGGGACTGG - Intronic
1122476535 14:102013800-102013822 GACCTCCAGGCACCAGGGACGGG + Intronic
1122582562 14:102780205-102780227 GAGGCCCAGACGCCCGGGAGAGG + Intronic
1122982302 14:105197192-105197214 GACCCCCAGACCCCAGGGCGGGG - Intergenic
1123629399 15:22250836-22250858 GACCCACAGCCGCTCTGGAGGGG + Intergenic
1125714338 15:41810789-41810811 GACTTCCAGTCACCCGGCAGAGG - Intronic
1129470582 15:75751378-75751400 GTCCCCCAGCCACAGGGCAGGGG - Intergenic
1129777352 15:78245512-78245534 GACCGCGAGCCCCCCGGGGGAGG - Intronic
1132592398 16:731656-731678 GCCCACCAGCCATCGGGGAGGGG - Exonic
1132744046 16:1429409-1429431 GACCCCCAGCTTCCAGGGAAGGG - Intergenic
1132872830 16:2123321-2123343 GTCCCCCAGCCCCCAGGGTGTGG + Intronic
1134134406 16:11669375-11669397 GCCCCTCAGGCACGCGGGAGAGG + Intronic
1134551918 16:15142500-15142522 GTCCCCCAGCCCCCAGGGTGTGG + Intergenic
1138563391 16:57815574-57815596 CACCCCCAGCCTCCCTGGTGAGG - Intronic
1139637638 16:68267810-68267832 TACCCCCAACCTCCGGGGAGGGG + Intronic
1141178751 16:81738273-81738295 GGTCCCCAGACCCCCGGGAGTGG - Intergenic
1142194909 16:88734862-88734884 GCCCCCCAGCCACCTGGAAGAGG + Exonic
1143450917 17:7036280-7036302 GGCCCCGAGCCACCCGGCAGCGG + Exonic
1143633696 17:8152484-8152506 GATCCCCAGCCAATCGGGGGCGG - Intronic
1143736117 17:8913152-8913174 GACCCCCCAACACCCTGGAGGGG - Intronic
1143869807 17:9949981-9950003 TAATCCCAGCTACCCGGGAGAGG - Intronic
1152179169 17:78807146-78807168 GCCCCCCAGACCCCCAGGAGTGG - Exonic
1152945042 17:83193567-83193589 GACCCCCACCCACCCAGGCCAGG - Intergenic
1154319126 18:13330801-13330823 CACCCCCACCCTCCAGGGAGGGG + Intronic
1154501929 18:15001524-15001546 CACCCCCATCCCCACGGGAGGGG - Intergenic
1156144588 18:34159772-34159794 GCTCCCCAGACACCCGGGAAGGG - Intronic
1156476034 18:37405884-37405906 GGCCCCCCTCCAGCCGGGAGTGG + Intronic
1157480081 18:48048194-48048216 GACCCCCAGCCCACAGGGATCGG - Intronic
1157712324 18:49858516-49858538 GCCCCCCACCCCCCAGGGAGGGG + Intronic
1158951530 18:62499663-62499685 GACCTCCAGCCACCAGGGCCAGG - Intergenic
1159122858 18:64190710-64190732 GAGCCCCTTCCACCCTGGAGGGG - Intergenic
1159647649 18:70938174-70938196 GAACCCCATCCACAAGGGAGTGG - Intergenic
1160246658 18:77165128-77165150 GACCCCCTCCTACCTGGGAGGGG + Intergenic
1160578424 18:79870032-79870054 GGCCCCCAGCCACCTGGGGGTGG + Intronic
1160718823 19:588907-588929 GCCCACCAGACAGCCGGGAGGGG - Intergenic
1160769083 19:822240-822262 CGACCGCAGCCACCCGGGAGGGG - Intergenic
1160889647 19:1370578-1370600 GACCCACAGCCACCCGAGGAAGG + Intronic
1161077680 19:2294310-2294332 GAGCCCCAGGAAGCCGGGAGAGG + Intronic
1161493472 19:4575334-4575356 GATCCCCAGCCTCTTGGGAGGGG - Intergenic
1161724013 19:5918147-5918169 TATTCCCAGCCACCTGGGAGTGG - Intronic
1162805981 19:13138355-13138377 GACCGCCAGCCACGAGGGCGAGG + Exonic
1165388410 19:35525004-35525026 CAGCCCCAGTCACCCTGGAGGGG - Intronic
1166301321 19:41913486-41913508 GACCCGCAGCCGCCCAGGACGGG + Intronic
1166809473 19:45506989-45507011 GACCCCCACCCGCACGGGAGTGG - Intronic
1166872005 19:45876795-45876817 GACCCCCAGGCCCGAGGGAGGGG - Intergenic
1166930395 19:46298320-46298342 GGCCCCCACCCAGCCAGGAGGGG - Intronic
1168128124 19:54298506-54298528 CACCCCCAGCCACCTGGGGATGG - Intergenic
926159082 2:10475336-10475358 GACCCCCAGCCCCCACGCAGAGG - Intergenic
926901149 2:17753529-17753551 GACCCCCAGCCACCCGGGAGAGG - Intronic
927492080 2:23527319-23527341 GCCCCCCAGCCACCCCAGGGTGG + Intronic
927929780 2:27036696-27036718 GATCCCCAGCCACACTGCAGGGG - Exonic
929431448 2:41890793-41890815 CACCCACAGCCTCCAGGGAGGGG + Intergenic
929670627 2:43874510-43874532 GCCCCCCACCCACCAGGGTGGGG + Intronic
929836898 2:45410693-45410715 GACCCCCAACCTCCAGGGAGGGG + Intronic
929873160 2:45774804-45774826 GACTCCCAGGCACACGGGAAAGG - Intronic
932001414 2:67888740-67888762 GGCCCCCAGCCTCCCTGGGGTGG + Intergenic
934027188 2:88010792-88010814 GACCCCCAACCTCCAGGGAGGGG - Intergenic
934856317 2:97732573-97732595 GACACCCAGCCACGGAGGAGGGG - Intronic
936444018 2:112581913-112581935 GACCCCCAGCAACCCTGGAGTGG - Intergenic
937907103 2:127057786-127057808 GACCCCAGGCCACCCCCGAGAGG + Intronic
938501109 2:131831693-131831715 CACCCCCATCCCCACGGGAGGGG - Intergenic
938696500 2:133840116-133840138 GAGGCCCAGCCAACAGGGAGGGG + Intergenic
940342809 2:152599114-152599136 GACGCCCAGCCACATTGGAGAGG + Intronic
944132467 2:196361673-196361695 GTCCCTCAGCCAGCTGGGAGGGG + Intronic
947549651 2:231037428-231037450 GACCCCCGGGCCCCCGGGCGGGG - Intergenic
948398817 2:237667868-237667890 GAAGCCCAGGAACCCGGGAGAGG - Intronic
1168902135 20:1373946-1373968 GAAACCCAGACACCTGGGAGTGG + Intronic
1170569014 20:17622492-17622514 CATCTCCAGCCACCCTGGAGAGG + Intronic
1170653872 20:18268082-18268104 GACCTCCAGGGAGCCGGGAGAGG + Intergenic
1171036618 20:21717260-21717282 GACCCCCAGCCGCGAGAGAGGGG - Intronic
1172363362 20:34330549-34330571 CACCCCCAACCTCCAGGGAGGGG + Intergenic
1174283731 20:49457519-49457541 GACCCCCAGACTCCCTGAAGTGG + Intronic
1174535045 20:51244984-51245006 CACCCCCAGCCACCTGTCAGTGG - Intergenic
1176026239 20:62986971-62986993 GGCCCACAGACACCCAGGAGGGG - Intergenic
1176232627 20:64039913-64039935 GGCCCCCAGCCTCCAGGCAGGGG - Intronic
1176375832 21:6086530-6086552 GCCCCCAGGCCACCCAGGAGTGG + Intergenic
1179435760 21:41361108-41361130 GCCCTCCAGACACCGGGGAGGGG - Intergenic
1179494733 21:41764405-41764427 GACCCCCAGCAGCCTGGAAGAGG + Intronic
1179747642 21:43451714-43451736 GCCCCCAGGCCACCCAGGAGTGG - Intergenic
1180048618 21:45321173-45321195 GACCCCCACCCACACACGAGGGG - Intergenic
1180048638 21:45321229-45321251 GACCCCCACCCACACACGAGGGG - Intergenic
1180081778 21:45490518-45490540 GAGGCCCAGAGACCCGGGAGTGG - Intronic
1181361100 22:22336745-22336767 GACCCCCAGCCCCCCCGGACAGG - Intergenic
1183063898 22:35350821-35350843 TACCTCCAGCCACCTTGGAGCGG - Intergenic
1184448439 22:44568178-44568200 GACCACCACCCACCAGAGAGTGG + Intergenic
1184521240 22:44995529-44995551 GAGCCCCAGACTCCTGGGAGGGG - Intronic
1184748848 22:46472775-46472797 GACCCCCAGCCCCCAGGGAAAGG - Intronic
1184931003 22:47681385-47681407 GTCCCACAGCCACCTGCGAGAGG - Intergenic
1185251518 22:49804142-49804164 CACCCCCACCCTCCAGGGAGAGG - Intronic
950709514 3:14804527-14804549 CACACCCAGCCAGCCAGGAGGGG + Intergenic
952764956 3:36945478-36945500 GACCCCCAGCCTCCCCAGAGTGG - Intergenic
953492642 3:43364092-43364114 GAACCTCGGCCACCCGGGGGAGG - Intronic
955773020 3:62405191-62405213 TACCCCCAGCCTCCTGGGATTGG + Intronic
956096861 3:65725524-65725546 GAGCCCCAGCCACCAGGGTTTGG - Intronic
961324808 3:126103738-126103760 GGGCCCCAGCCACGAGGGAGGGG + Exonic
964970491 3:162553805-162553827 TAGCCCCAGCCACCATGGAGTGG - Intergenic
968471434 4:784450-784472 GACCGCCAGCAACCAGGCAGAGG + Intergenic
968575070 4:1362230-1362252 GAACCCCAGCCACCGCGGGGAGG - Intronic
968674396 4:1870186-1870208 CACCTCCAGCCACCAAGGAGTGG - Intergenic
968727691 4:2255892-2255914 CACCCCCAGCTCCCCGGCAGCGG - Intronic
968744129 4:2350674-2350696 CACCCCCAACCTCCGGGGAGGGG + Intronic
969311895 4:6357715-6357737 TACCCCCACCCACCAGGGTGAGG - Intronic
969553519 4:7889426-7889448 TAGCCCCAGCTACTCGGGAGAGG + Intronic
970628203 4:17912906-17912928 GACCACCAGCCACCGGATAGTGG + Intronic
970888414 4:21013443-21013465 GACCCCCAGACACCAGGCATGGG + Intronic
977979816 4:103307981-103308003 GACAGCCACCCACCCAGGAGTGG - Intergenic
982163182 4:152590519-152590541 GACCAGCAGCCACCCAGGAATGG + Intergenic
986299223 5:6465558-6465580 CACCCCCAGGCACTGGGGAGTGG - Intronic
986512766 5:8525567-8525589 GACACCCAGCCACTTGGCAGTGG + Intergenic
987999484 5:25330676-25330698 CAGCTGCAGCCACCCGGGAGTGG + Intergenic
988476708 5:31592414-31592436 CACCCCCAGTCACCTGGGACAGG - Intergenic
988566032 5:32320616-32320638 GAGCCCCACCCTCCCAGGAGTGG - Intergenic
989077112 5:37575473-37575495 TACCCCCATCCTCCAGGGAGAGG + Intronic
998423276 5:142006466-142006488 GACCCCTAGCCACTCGGCACAGG + Intronic
999753721 5:154648826-154648848 CAGCCCCAGCCACTCTGGAGGGG - Intergenic
1001032111 5:168270562-168270584 GATTCCCAGCCACCTGGGAGGGG - Intergenic
1002300888 5:178256799-178256821 GACCTCCACCCAGTCGGGAGTGG - Intronic
1002528537 5:179829335-179829357 GACCCCCAGGCACCCTGCAGAGG + Intronic
1002543842 5:179925227-179925249 ACCCCCCAGCCTCCAGGGAGCGG + Intronic
1002561996 5:180088789-180088811 ACCCCCCAGCCTCCGGGGAGCGG - Intergenic
1002903372 6:1428322-1428344 GAGCCCCAGTCACCCAGGAGAGG + Intergenic
1004906608 6:20242415-20242437 CTCCCCCACCCACCAGGGAGGGG - Intergenic
1005999786 6:30955862-30955884 AGCCCCCAGCCCCCAGGGAGGGG + Intergenic
1006225724 6:32535015-32535037 GAGCCCCAGGCACCCCTGAGTGG + Intergenic
1006554390 6:34853023-34853045 CACCCCCAGCCTCCTGGCAGTGG - Intronic
1007385776 6:41519456-41519478 AACCCCCATCCAGCAGGGAGAGG + Intergenic
1007516542 6:42417397-42417419 GTCCACCAGGCACCCGGCAGAGG + Intronic
1008090460 6:47288921-47288943 GGCCTGCAGCCACCCAGGAGAGG + Intronic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1019133569 6:169894580-169894602 GACCCCCAGCTCCCGGGGACAGG + Intergenic
1019329174 7:454279-454301 GACCCCTCGCCACCCGGGGGGGG - Intergenic
1019508310 7:1404689-1404711 GTCCCCCAGCCCCCTGGGTGTGG + Intergenic
1019531156 7:1504156-1504178 GCCTCCCAGCCGCCCGGGAGCGG + Intronic
1026968474 7:74454385-74454407 GCCCCCCACCTGCCCGGGAGGGG + Intronic
1029538423 7:101169156-101169178 GACCCCCACCCACTCCTGAGTGG + Intergenic
1029580730 7:101435400-101435422 GCCTCCCAGCCAGCAGGGAGGGG - Intronic
1034274630 7:149818642-149818664 GGGCCCCAGCCACCTGGGGGAGG - Intergenic
1035005322 7:155653561-155653583 AACCCCCAGCCTCCCTCGAGGGG + Intronic
1035828009 8:2665172-2665194 AAGCCCCAGCCACCTGGGGGCGG + Intergenic
1035888979 8:3324002-3324024 AACCCCCAGAGACCCAGGAGGGG + Intronic
1035889029 8:3324216-3324238 CAACCCCAGAGACCCGGGAGGGG + Intronic
1035889096 8:3324502-3324524 AACCCCCAGAGACCCAGGAGGGG + Intronic
1035889113 8:3324573-3324595 AACCCCCAGGGACCCAGGAGTGG + Intronic
1035999408 8:4583976-4583998 GACCACAAGCCCACCGGGAGGGG + Intronic
1037579450 8:20235982-20236004 GACCCCCAGCACCCTGGGGGTGG - Intergenic
1037892122 8:22628946-22628968 GCCCCCCAGCCTCCCCAGAGTGG - Intronic
1039883850 8:41644497-41644519 GACCCCCAGACCCCCAGGATGGG - Intergenic
1040107286 8:43548078-43548100 GCCCCCCAGGCACCCTGGGGTGG + Intergenic
1042142517 8:65693667-65693689 GAGTCCCAGCCACCCAGGAGAGG + Exonic
1046932534 8:119855821-119855843 AGCCCGCAGCCACCCGGGCGCGG - Exonic
1047201319 8:122770160-122770182 GACCCCCAGCCACCAGGCTGGGG + Intergenic
1048315145 8:133356229-133356251 GAGCCACAGCCTCCCGGGACAGG - Intergenic
1049206739 8:141367091-141367113 CACCCCCAGCCAAGCAGGAGTGG - Intronic
1049563518 8:143325291-143325313 GGACCCCCGCCACCCGGGTGAGG - Intronic
1052772219 9:32700066-32700088 GACCACCAGCCACAGGGCAGGGG + Intergenic
1053159657 9:35805281-35805303 GGCACCCAGCCACCAGGGACAGG - Intronic
1053291629 9:36883159-36883181 GCCCCCCTGCCCCCTGGGAGTGG + Intronic
1054459306 9:65454239-65454261 GACTCCCAGGCACCCGGGCTTGG - Intergenic
1056956418 9:91085161-91085183 CATCCCCAGCCTCCAGGGAGGGG + Intergenic
1060519474 9:124286179-124286201 GGCCCCCAGCCAGCCCGAAGAGG - Intronic
1061478584 9:130885128-130885150 CAAGCCCAGCCAGCCGGGAGAGG + Exonic
1061650466 9:132044200-132044222 GTCCCTCAGCCACCAGGCAGTGG - Intronic
1061674764 9:132209516-132209538 GCCCCAAAGCCACGCGGGAGCGG + Intronic
1061848656 9:133402169-133402191 GAGCCCCAGCCTCCCAGAAGGGG - Intronic
1061927139 9:133811458-133811480 GACCCCCAGGCTCCCAAGAGTGG - Intronic
1062052268 9:134453784-134453806 GGGCCCCAACCACTCGGGAGGGG - Intergenic
1062234131 9:135500068-135500090 GGCCCCCAGCCACCCGCGGGGGG + Intronic
1062498556 9:136842823-136842845 CACCCCCATCCCCACGGGAGGGG + Intronic
1062731879 9:138114481-138114503 GGCCGCCAGCTACCTGGGAGAGG - Exonic
1189363412 X:40370400-40370422 GCCCCACAGCCACCAAGGAGGGG - Intergenic
1189509939 X:41652583-41652605 CACCCCCAACCTCCAGGGAGGGG + Intronic
1189709556 X:43795520-43795542 CACCCCCAGCCTCCAGGGAGGGG - Intronic
1190081455 X:47359764-47359786 CACCCCCAACCTCCTGGGAGGGG - Intergenic
1194205199 X:91003210-91003232 GAGCCCCACCCTCCCGGGCGGGG - Intergenic
1195325667 X:103756323-103756345 CACCCCCAGCCTCCTAGGAGGGG - Intergenic
1195784150 X:108500238-108500260 GATCCCCAACCACCCAAGAGCGG + Intronic