ID: 926902115

View in Genome Browser
Species Human (GRCh38)
Location 2:17763519-17763541
Sequence CAGTGGATTAGGAGGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 312}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926902115 Original CRISPR CAGTGGATTAGGAGGAAGCA GGG (reversed) Intronic
901071381 1:6520679-6520701 GAGTGTATTAGAAGGAAACAGGG - Intergenic
903790396 1:25889026-25889048 CAGTGGATTAGGATGAAAACTGG + Intronic
905357257 1:37393527-37393549 CAGTGGTCCCGGAGGAAGCAGGG - Intergenic
905762936 1:40575525-40575547 CAGTGCCTTAGGAGAATGCAGGG + Intergenic
907251160 1:53140852-53140874 CAGTTATTTAGGAAGAAGCATGG - Intronic
908263155 1:62354240-62354262 CACAGGATTAGGAGGCAGGAAGG + Intergenic
908274028 1:62450500-62450522 CATTGAATGAGGAGGAAGCAAGG + Exonic
908690628 1:66775596-66775618 AAGTGGATTAGGAGCCAGGATGG + Intronic
910991493 1:93061278-93061300 CAGTGAATAAGGAGAAGGCAGGG - Intergenic
911104269 1:94117741-94117763 CCGTGGAGTAGAAGGAAACACGG - Intronic
914385202 1:147162473-147162495 AAGTAGATGAGGAGGAAGGATGG + Exonic
914702551 1:150148457-150148479 CATTGGATTAGGAGGAAAGGTGG + Intergenic
915834289 1:159162697-159162719 AAGTGGCTTAGCATGAAGCAGGG + Intergenic
915839892 1:159205298-159205320 CAGTGGAAAAGGACAAAGCAGGG - Exonic
915917643 1:159950639-159950661 CAGGGGGTTAGGGGGAAGCGAGG - Intergenic
916338938 1:163706655-163706677 CAGAAGATTAGGGGGAAGCGGGG - Intergenic
916472945 1:165141634-165141656 TAATGGAATAGGAGGAAGGAGGG - Intergenic
917072546 1:171168483-171168505 CAGAGTATTAAGAGGGAGCAAGG - Intergenic
917127097 1:171696653-171696675 CAGTGGTTGAGGAGGAGGAAGGG + Intergenic
917452458 1:175158311-175158333 CATTGGATTAGGAGACAGCAGGG + Intronic
918118363 1:181516255-181516277 GGGTGGATAAGGAGAAAGCAGGG + Intronic
918471493 1:184880315-184880337 CAGTGGATGAGAGGGTAGCATGG - Intronic
919880990 1:201900494-201900516 CAGTGGATAAGAAGGAGGCAGGG - Exonic
920352874 1:205349326-205349348 CACTGGAGTGGGAGGGAGCAGGG - Intronic
920861352 1:209710051-209710073 CAGTGGGGTAGGAGAAAGAATGG + Intronic
921627088 1:217388716-217388738 CACTGGCTTTGGAGGAACCACGG - Intergenic
922210708 1:223484297-223484319 CAGTGGATCACGGGGAACCATGG + Intergenic
1063059077 10:2532131-2532153 CAGAGGCTTAGGTGGAAGGATGG - Intergenic
1064433088 10:15287928-15287950 CAGTGGATTTGGAGGACTCAGGG - Intronic
1064744691 10:18466858-18466880 CAGTGGAATAGGATGAGGCTGGG + Intronic
1065589065 10:27247632-27247654 CAGAGGATCAGGAGGGAACAGGG - Intergenic
1065684499 10:28270389-28270411 AAGGGGAGTAGGAGGAAGCCAGG + Intronic
1066372005 10:34825227-34825249 GAGGGACTTAGGAGGAAGCATGG - Intergenic
1066546686 10:36507736-36507758 CAGTGGTTTACCAGGAAGCTTGG + Intergenic
1068931471 10:62594647-62594669 CAATGCCTTATGAGGAAGCAAGG + Intronic
1072527340 10:96285070-96285092 CAGAGCCTTTGGAGGAAGCATGG - Intergenic
1073239006 10:102042279-102042301 CAGTTGATTAGCAGGAAGAGTGG + Intronic
1074160765 10:110834762-110834784 CACTGGATTAGGAGACAGAAGGG - Intronic
1074486672 10:113890889-113890911 CAGAAGATGAGGAGGAAACAAGG + Intronic
1074847178 10:117408604-117408626 CAGAGGCTTAGGAGGGAGCATGG + Intergenic
1074873766 10:117598067-117598089 CAGTGGCTTAGGGGTCAGCATGG - Intergenic
1075722855 10:124597607-124597629 CAGTGGCCCAGGAGAAAGCAGGG - Intronic
1076002950 10:126926826-126926848 CAGAGGGTTTGGAGGGAGCATGG + Intronic
1076110589 10:127856349-127856371 CAGAGGCTTCGGAGGGAGCATGG - Intergenic
1077353980 11:2106274-2106296 TGGTGGATAGGGAGGAAGCATGG - Intergenic
1077517505 11:3010715-3010737 CAGTGGAGCAGGAGGCAGGAGGG - Intronic
1077975122 11:7239755-7239777 GATTGGATTAGGAGGGAGAAGGG + Intronic
1078108613 11:8374078-8374100 AACTGGATTTGGAGGCAGCAAGG - Intergenic
1081244309 11:40746061-40746083 CAATGAAGGAGGAGGAAGCAAGG + Intronic
1085406519 11:76266322-76266344 CAGTCCATCAGTAGGAAGCAGGG + Intergenic
1087658730 11:100959880-100959902 CAGTGTATTTGAATGAAGCAGGG + Exonic
1087851625 11:103037446-103037468 CAATCTATTAGGAAGAAGCAGGG + Intergenic
1087963944 11:104389344-104389366 CAGTGGAACAGGATGAAGCAGGG + Intergenic
1088589742 11:111393158-111393180 CAGTGGATTTGGAGGAAACTTGG - Intronic
1089701885 11:120249702-120249724 CAGAGGGTCAGGAGGAAGGAGGG + Intronic
1089784830 11:120900553-120900575 CAATGAATTAGAAGGCAGCAAGG + Intronic
1090314672 11:125775109-125775131 CAGTGGATTAAGAGGAAAAAAGG - Intergenic
1090414082 11:126528808-126528830 GAGAGGAAGAGGAGGAAGCAGGG + Intronic
1091075180 11:132608857-132608879 CAGTGGAGCAGGAGGAAGCAAGG - Intronic
1091125659 11:133093237-133093259 CATTGGATTTGGGGGACGCAGGG - Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1093034215 12:14317877-14317899 CAGTGGCTCTGGAGGGAGCATGG - Intergenic
1093097271 12:14985634-14985656 AACTGGAGTAGGAGGAAGCCAGG + Intergenic
1093692620 12:22125181-22125203 CAGAGGCTTAGGAGGAAAAATGG + Intronic
1094502402 12:31033119-31033141 CAGAGGAGTGGGAGGAAGGAGGG - Intergenic
1095485593 12:42681064-42681086 GAGTGGATTAGAAGGAACTAAGG - Intergenic
1096633162 12:52942570-52942592 TAGTGGAAAAGGAGGAAGCCCGG - Intronic
1097295173 12:57955048-57955070 CAGTGGAGAGGGTGGAAGCAGGG + Intronic
1098584915 12:72143371-72143393 GAGAGGAGTAGGAGGAAGGAGGG + Intronic
1098838878 12:75455045-75455067 TAGTGGCTTGGGAGGGAGCATGG - Intergenic
1100912469 12:99381107-99381129 TAGTGCATTTGGAGGGAGCATGG + Intronic
1101502851 12:105320216-105320238 CAGTGGATTCGTAGGCAGGAGGG + Intronic
1102360925 12:112286904-112286926 CCCAGCATTAGGAGGAAGCATGG - Intronic
1103972674 12:124681912-124681934 CAGGGGCTTTGGAGGGAGCAGGG - Intergenic
1105520915 13:21130145-21130167 CAGTGAATTAGGAGGATGGCGGG + Intergenic
1105543344 13:21333842-21333864 CAGTGGCTGAGGAGGAAGACAGG - Intergenic
1105771296 13:23614615-23614637 CAGTGGCTTAAGAGCAAGAAGGG - Intronic
1106121770 13:26865666-26865688 CACTGGAGCAGGAGGGAGCAAGG - Intergenic
1106320614 13:28634442-28634464 TAGTGGAAAAGGAGGAAGGAAGG + Intergenic
1107642313 13:42456157-42456179 TGGTGGATTAGGATAAAGCATGG - Intergenic
1108489707 13:50969255-50969277 ATGTGGATGAGAAGGAAGCAAGG - Intronic
1108914679 13:55591967-55591989 CAGTGAATCAGGAGTAAACAGGG + Intergenic
1109879278 13:68450554-68450576 CAGAGGTTTAGGAGGAAAAATGG + Intergenic
1110852789 13:80263504-80263526 CAGAGGCCTAGGATGAAGCATGG - Intergenic
1111338150 13:86848158-86848180 CAGTGCATTGAGAGGGAGCATGG + Intergenic
1113954599 13:114090738-114090760 CTGTGAATTTAGAGGAAGCAAGG - Intronic
1114297222 14:21340822-21340844 TAGTGGAATAGGAGAATGCATGG - Intronic
1115051893 14:29072815-29072837 CAGAGGCTTAGGAGGAAAAATGG - Intergenic
1115946217 14:38664192-38664214 CAGTGAAATAGAAGGAAGGAGGG + Intergenic
1115968479 14:38918325-38918347 CAGAGGAAAAGGAGGAAGGAAGG + Intergenic
1116609735 14:47052888-47052910 CAGAGGATTAAGAGGAAGAGAGG - Intronic
1116966581 14:51021557-51021579 CAGGGGAGCAGGAGGAGGCAGGG - Intronic
1117451469 14:55854185-55854207 CAGTGAATGAGAGGGAAGCATGG - Intergenic
1117951709 14:61089524-61089546 CAGTGGCTTAGGTGGGAGGAGGG + Intergenic
1118110767 14:62716550-62716572 CAGTGGGTGAGGAGGAAGAAGGG - Intronic
1120265480 14:82244124-82244146 GTGTGGATTTGGAGGAAGGATGG - Intergenic
1120422878 14:84310821-84310843 CAGAAGATGAAGAGGAAGCAAGG + Intergenic
1120886802 14:89458117-89458139 CAGGAGATTTGGAGGAAGGAAGG + Intronic
1121303504 14:92890316-92890338 CAGAGGAGTAGGAGGATGAAGGG - Intergenic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1124823882 15:33074258-33074280 CTGTGAATTAGGTAGAAGCAAGG - Intronic
1125906893 15:43401144-43401166 GAGTGGATTAGGATGGGGCAGGG + Intronic
1126437258 15:48648064-48648086 CCATGGATTAGGAGAAAGCAGGG + Intergenic
1127019949 15:54735643-54735665 GAGTGTATTTGGAGCAAGCAGGG - Intergenic
1130460206 15:84154588-84154610 CAGGGGAGTAGAAGGAAGAAAGG - Intergenic
1130857486 15:87853795-87853817 CAGTGGATGAGGAGGATGTTGGG + Intergenic
1131072967 15:89477442-89477464 CAGAGGAATAGCAGGAAGAAGGG + Intronic
1131435407 15:92417937-92417959 CAGAGAATTAAGAGGAAGCAAGG - Intronic
1131699704 15:94921160-94921182 CAGAGGATGAAAAGGAAGCAAGG + Intergenic
1132070422 15:98771881-98771903 CAGTGGAGAAGAAGGAAGGAGGG - Intronic
1132638855 16:967834-967856 CAGTGGACAGCGAGGAAGCAGGG - Intronic
1132640891 16:977785-977807 CAGGGCACGAGGAGGAAGCAGGG - Intronic
1133072564 16:3256278-3256300 CACTGGATGAGGAGGAGGCCTGG + Intronic
1133132739 16:3687741-3687763 CAGAGGCTGAGGAGGAAGGATGG + Intronic
1133319580 16:4904656-4904678 CTGTGGATAGGGAGGAAACAGGG + Intronic
1133653529 16:7835904-7835926 CAGTGGCTTTGCAGGCAGCAAGG + Intergenic
1134383690 16:13751906-13751928 CAATGGATGAGGAGCCAGCATGG - Intergenic
1134808477 16:17146109-17146131 CAGTGGATTTGTGGGAAGCCCGG - Intronic
1134880863 16:17744805-17744827 GAGTGAGTTAGGAGGAGGCAGGG + Intergenic
1134906124 16:17981310-17981332 CAGTGGATGGGCAGGAAGGATGG - Intergenic
1136052749 16:27664516-27664538 AACTGGATTTGGAGGAGGCATGG + Intronic
1138776351 16:59728840-59728862 CATTGAAGTAGGAGGAAGCTAGG + Intronic
1138877517 16:60970725-60970747 CAGTTGCCTATGAGGAAGCAGGG + Intergenic
1141240302 16:82259758-82259780 CAGAGCCTTTGGAGGAAGCATGG - Intergenic
1141433354 16:83982436-83982458 CGGTGGATTAGAAGGTAGCATGG + Intronic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1141848824 16:86630217-86630239 CAGAGGCTAAGGAGGAGGCAGGG + Intergenic
1144042252 17:11422392-11422414 CAGTGGAATACCAGGAAGGAGGG + Intronic
1144713759 17:17420372-17420394 CAGTGTGCAAGGAGGAAGCAGGG + Intergenic
1145105148 17:20109216-20109238 CAGTGGAGTAGGATGGAGCAGGG + Intronic
1146514827 17:33480866-33480888 CAGTGGAAGAGAAGGAGGCATGG - Intronic
1148857340 17:50585935-50585957 CAGTGGAGCAGGTGGAAGCTGGG + Intronic
1149261812 17:54888297-54888319 CATTTGACGAGGAGGAAGCATGG - Intergenic
1149930594 17:60750843-60750865 CAGTGGATAAGGAACAAGAAGGG - Intronic
1150055454 17:62010792-62010814 CATTGGTTTAGAAGGAACCAAGG + Exonic
1150963997 17:69947036-69947058 CAGTGGAATGGGAAGAAGCTGGG + Intergenic
1156129888 18:33959054-33959076 CAGAGGATTAGGAAGAAACCCGG - Intronic
1156737464 18:40277896-40277918 CAGAGGCTTTGGAGGGAGCATGG + Intergenic
1157220884 18:45827850-45827872 CAAAGGATTTAGAGGAAGCATGG + Intronic
1157701213 18:49762463-49762485 CAGTGTATCAGGCGGAAGCTTGG + Intergenic
1158100787 18:53827815-53827837 CACAGGATTAACAGGAAGCATGG - Intergenic
1159215522 18:65386789-65386811 CAGTGGCCTAGGAGGAAAAATGG + Intergenic
1159266952 18:66093355-66093377 CATAGGAAGAGGAGGAAGCAGGG + Intergenic
1159594944 18:70373913-70373935 CAGTGAATCAGGAAGAAGGAAGG - Intergenic
1160005638 18:75067249-75067271 CAGTGGATGTGGAAGAAGCAGGG + Intergenic
1160983266 19:1826415-1826437 GAGGGGATGAGGAGGAGGCAAGG + Intronic
1161035071 19:2079934-2079956 CAGGGGAGTAGGAGGACGCCGGG - Intronic
1161347400 19:3775161-3775183 CAGTGGATTAGGCAGAGGCCAGG + Intergenic
1163083234 19:14958672-14958694 CAGGGGATGAGGTGGAAGGATGG - Intronic
1163511774 19:17739693-17739715 CAGTGGACTAAGAGGTAGCAAGG - Intergenic
1163701607 19:18789263-18789285 CAGCGGACTCGGGGGAAGCAGGG + Exonic
1163820216 19:19492173-19492195 CAGGGGATGTGGAGGATGCAGGG + Intronic
1164592088 19:29512732-29512754 GAGGGGATGAGGAGGAAGGAGGG + Intergenic
1164592609 19:29514496-29514518 CAGGGGATGAGGAAGAAGGAGGG + Intergenic
1167190858 19:47988573-47988595 AAGAGGATGAGGAGGAACCATGG - Intronic
1167771971 19:51526299-51526321 CAGAGCACTAGGAGGGAGCATGG + Intronic
926902115 2:17763519-17763541 CAGTGGATTAGGAGGAAGCAGGG - Intronic
930231034 2:48843976-48843998 CACTGGGGTAGGAGGAAGGATGG + Intergenic
930674956 2:54190629-54190651 CAGGAGATGAGGAGGAACCATGG - Intronic
931992796 2:67807891-67807913 AAGTGGAGGAGGAGGAAGAAGGG - Intergenic
934850886 2:97700478-97700500 CAGATGGGTAGGAGGAAGCAGGG - Intergenic
936781732 2:116040928-116040950 AAGTGGATTCAGAGGAAGAAGGG + Intergenic
937022045 2:118666181-118666203 CAGTGGATTTGCAGGAGGCATGG - Intergenic
937275103 2:120679163-120679185 CAGGGGAGGAAGAGGAAGCAGGG - Intergenic
937451151 2:122003037-122003059 CAGTGGTTCAGGGGGCAGCAGGG + Intergenic
938990534 2:136623772-136623794 CAGATGAATAGGAGGAAGAAAGG + Intergenic
940688660 2:156885901-156885923 TAGAGGCTTAGGAGGGAGCATGG + Intergenic
940851393 2:158690862-158690884 CAGTGCTTGAGGTGGAAGCATGG - Intergenic
941474385 2:165931679-165931701 AAGTGGAAAAGGTGGAAGCAGGG - Intronic
941850772 2:170177656-170177678 CAGTAGGTTAAGAGGAGGCAGGG - Intergenic
941956203 2:171207372-171207394 AAGTGCATTAGCAGGAAGGAGGG + Intronic
942340609 2:174941494-174941516 TACTGGATTAGGGGGAACCAGGG - Intronic
942571867 2:177323175-177323197 CAGTGGAGGAGGAGGGAGCAGGG - Intronic
942969820 2:181944542-181944564 CACTGGATTAGAAGGAAGTTAGG + Intergenic
943954270 2:194166523-194166545 CAGTGGATTATGAAGGAACATGG - Intergenic
945060601 2:205905553-205905575 CAGTGGATCTTGGGGAAGCACGG - Intergenic
946717512 2:222568178-222568200 CAGGGAATCAGGAGGAAGAAAGG + Intergenic
947032131 2:225808303-225808325 CAGAGGAGCAGGAGGAAGCTTGG - Intergenic
947374358 2:229480976-229480998 CTGGGGTGTAGGAGGAAGCAGGG + Intronic
947500414 2:230667211-230667233 CAGTGCTTTTGGAGGGAGCATGG - Intergenic
947636308 2:231682342-231682364 CTGGGGATTAGGAAGAGGCAGGG - Intergenic
948302878 2:236921341-236921363 CAGTGGATTAGGGGAAATCAAGG + Intergenic
1169456627 20:5758154-5758176 AAGTGCAGTGGGAGGAAGCAGGG + Intronic
1169608719 20:7353959-7353981 CAGTGGATTAACAGGAAACCAGG - Intergenic
1169663551 20:8007421-8007443 CAGGGGATCAGAAGAAAGCAGGG - Intronic
1171203238 20:23258350-23258372 AAGTGGCTTAGGAGTGAGCAGGG - Intergenic
1171294349 20:24004601-24004623 CAGTGGATAAGGAGATAACAGGG - Intergenic
1171459557 20:25291093-25291115 CAGTGGAGTTGGGGGAAGCTGGG - Intronic
1171870107 20:30518398-30518420 GAGAGAAATAGGAGGAAGCAAGG + Intergenic
1171950780 20:31419757-31419779 CAGAAGATGAAGAGGAAGCAAGG - Intergenic
1172066877 20:32227652-32227674 CTGTGTATGAGGGGGAAGCAGGG + Intronic
1173001995 20:39111497-39111519 CAGTGGAGCAGGAGGAAGAAGGG + Intergenic
1174030585 20:47622250-47622272 GAGTGGATTAGGAGAAAACTTGG + Exonic
1174256225 20:49257633-49257655 AAGGGGATGAGGAGGAAGAAGGG - Exonic
1175509241 20:59511206-59511228 CAGTGGACTTGGAGGACTCAGGG - Intergenic
1176002724 20:62840227-62840249 GAGTGGATTTGGAGTGAGCAGGG - Intronic
1177495192 21:21879609-21879631 AATTTGATTAGGAGGAAGAAAGG + Intergenic
1177829792 21:26125238-26125260 CAGTGTATGAGGAGGATGCGGGG + Intronic
1179109457 21:38433899-38433921 CAGAGGATTAGGAAGGAGGATGG - Intronic
1180119408 21:45736874-45736896 CAGTGGCTGTGGAGGAAACAGGG + Intronic
1180700948 22:17781205-17781227 CAGGGGCTTAGGAGGCACCATGG - Intergenic
1182693586 22:32180728-32180750 TGGTGCATTAGGAGAAAGCATGG - Intergenic
1183278083 22:36913864-36913886 CAGTGGATGGGGAGGCAGCCAGG + Intronic
1184202167 22:42977863-42977885 CACAGGCTTAGCAGGAAGCATGG - Intronic
1184730096 22:46367093-46367115 CAGTGGAAAAGGAGGACGAAGGG + Exonic
1184991691 22:48174613-48174635 CAGTGGTGTAGGAGGCAGCCTGG - Intergenic
1185004386 22:48267167-48267189 CAGTGGTCTGGGATGAAGCAGGG - Intergenic
950145021 3:10642851-10642873 CAGTGTATGGGGAGGAAGCAGGG - Intronic
950186370 3:10948098-10948120 CAGGGGCTTGGGTGGAAGCATGG + Intergenic
951089520 3:18556043-18556065 CAGGGGATTTGGAGGAAAGATGG - Intergenic
952042909 3:29281600-29281622 TAGTGGTTTAAGAGGAAGCTCGG + Exonic
952190985 3:31023474-31023496 CAGTGGAACAGGAGGAAGGGAGG - Intergenic
952296149 3:32063801-32063823 CAGAGGATGAACAGGAAGCAAGG - Intronic
952894224 3:38066098-38066120 CAATCCATCAGGAGGAAGCATGG + Intronic
954398009 3:50303236-50303258 CAGTGGCTCATGGGGAAGCAGGG - Exonic
954437277 3:50502985-50503007 CGGGGGATTTGGGGGAAGCAGGG + Intronic
954542299 3:51401865-51401887 CAGTGGAGTAGGCCGAAGCCTGG - Intronic
955826254 3:62951221-62951243 CAGAGGCCTAGGAGGAAACATGG + Intergenic
956734738 3:72229590-72229612 CAGAGGATGAGGAGCATGCAGGG - Intergenic
959563429 3:107809284-107809306 CAGTAGTTTAGCAGGCAGCATGG - Intronic
962149519 3:132878187-132878209 CAGGGGAATAGGAAGAAGCGGGG + Intergenic
962978005 3:140463147-140463169 CAGGGGCTGAGGAGGAATCATGG - Intronic
963003974 3:140708776-140708798 GAGAGGATGAGGAGGAAGGAAGG + Intergenic
963071818 3:141311168-141311190 CAGTGGATGATGAGGGATCAGGG - Intergenic
964466734 3:157001009-157001031 CAGAAGATGAAGAGGAAGCAAGG - Intronic
966050095 3:175605395-175605417 CAGTGCATCAGCAGGAAGTAGGG + Intronic
970588419 4:17536871-17536893 CAAGGGAGTAGGAGGAAGGAGGG + Intergenic
971417132 4:26442160-26442182 CGGTGGATTAGGTGAAGGCAAGG - Intergenic
972261778 4:37415980-37416002 CAGTGGATCAGCAGGATGTATGG + Intronic
973238253 4:47929472-47929494 CTGACGATTAGGAGAAAGCAAGG + Intronic
974020006 4:56684765-56684787 AAGAGAATTAGGAGGAAGAATGG + Intergenic
974600347 4:64071522-64071544 CACTGGCTTAACAGGAAGCATGG - Intergenic
974912599 4:68141297-68141319 CAGTGATTTAGGAGGAAGAGTGG - Intergenic
977321090 4:95517240-95517262 AATTGTATTTGGAGGAAGCAGGG - Intronic
978292817 4:107165591-107165613 CAGTGGCTGAGAAGGAAGGAGGG + Intronic
978885317 4:113761306-113761328 CAGTGGAGAAGAAGGAAGCGAGG - Intronic
981191600 4:141871460-141871482 CAGAAGATGAAGAGGAAGCAAGG + Intergenic
982112334 4:152068193-152068215 CAATGGATTATGAGCAGGCATGG - Intergenic
983035854 4:162864954-162864976 CAGTGCTGTTGGAGGAAGCATGG + Intergenic
984539908 4:181024538-181024560 TAGAGGCTTTGGAGGAAGCATGG - Intergenic
984810403 4:183791214-183791236 CAGTGGATGGTGACGAAGCATGG + Intergenic
985103499 4:186480391-186480413 AAGGGGATTAGGAGAAAGGAGGG - Intronic
985917044 5:2930147-2930169 CAGTGGGAGAGGAGAAAGCAAGG - Intergenic
986769441 5:10958391-10958413 CAGGGGATGTGGAGGAAGGAGGG - Intergenic
987468353 5:18299320-18299342 TAGTGGAGCAGGAGGAAGAAAGG + Intergenic
987752031 5:22052426-22052448 CAGGGGATTAGAGGGAGGCAGGG - Intronic
987946371 5:24614398-24614420 CATTGGATCAGGAGGGAGCATGG - Intronic
988895223 5:35665199-35665221 CAGTGGTGTAGCAGGGAGCAAGG + Intronic
988932331 5:36048466-36048488 CTATGGATTCGGAGTAAGCAGGG - Intronic
989264928 5:39462558-39462580 CAGTGGATTTAGAGGGAGCCCGG - Intergenic
989984586 5:50683004-50683026 TTGTGGATTAGGAGGAGGAAGGG + Intronic
990131877 5:52596077-52596099 CAGTGGATTAGGTGCCAGTATGG - Intergenic
990688516 5:58335512-58335534 CAGTGGGTAAGAAAGAAGCAAGG - Intergenic
993448330 5:88042702-88042724 CAGTGAGCTAGGGGGAAGCATGG + Intergenic
994881967 5:105509581-105509603 CAGTGGGGTAGGAGGAAGTTAGG + Intergenic
996383485 5:122885705-122885727 CAGTGGATTTGGAATAAGGATGG + Intronic
996777794 5:127151681-127151703 CAGAGGATAAGGAGGAAGAAAGG - Intergenic
997769666 5:136543007-136543029 ACGTGGATTAGGAGGAATCCCGG + Intergenic
998001737 5:138631075-138631097 CACTGGCTTTGGAGGAGGCAGGG - Intronic
998113373 5:139518718-139518740 CAGAGGCTGAGGAGGAAGAATGG - Intergenic
998206346 5:140159426-140159448 CAGTCTGTTAGGAGGAAGGAGGG - Intergenic
999434087 5:151549540-151549562 AAATGGAATAGGAGGAGGCAGGG + Intronic
1001050427 5:168409588-168409610 CAGTTGGTGAGGAGGAAACAGGG - Intronic
1001134108 5:169088355-169088377 CAGGGGAGTAGGAGGCAGTACGG - Intronic
1004289039 6:14349992-14350014 CAGTTGATTAGGTAGGAGCAGGG + Intergenic
1005925758 6:30444221-30444243 CAGTGGAGCAGGAGGAGGAAGGG - Intergenic
1005947187 6:30603143-30603165 CAGTGGAGTTGGGGGAAGCAGGG - Intronic
1008870350 6:56265454-56265476 AAGTGGAATAGGAGGAAGGACGG - Intronic
1009284776 6:61803128-61803150 ATGAGGAGTAGGAGGAAGCAAGG - Intronic
1009510246 6:64541650-64541672 CAGTGGATTAGGAAGGTGAATGG - Intronic
1010813674 6:80329573-80329595 CAATGGAGCAGTAGGAAGCAGGG - Intronic
1010879882 6:81154080-81154102 CAGAGGTTTAGGAGGAAAAATGG - Intergenic
1010929531 6:81784100-81784122 TAGTGGATTAAGAGATAGCAGGG + Intergenic
1011063249 6:83295021-83295043 CAGAGCATTAAGAGGGAGCATGG + Intronic
1011774378 6:90712173-90712195 CACTGGATTAGGAGTTAGTAAGG - Intergenic
1011893463 6:92195046-92195068 CAGTGGGTCAGGATGAAGCCAGG - Intergenic
1012442129 6:99270541-99270563 CAGTGGAGAAGGAGGTAGCCAGG + Intergenic
1014457161 6:121649115-121649137 CAGAGGATAAGAAAGAAGCAAGG + Intergenic
1015130051 6:129799001-129799023 TAGTGCCTTCGGAGGAAGCATGG + Intergenic
1015680469 6:135802081-135802103 TAATGGATTAGGGGTAAGCAAGG + Intergenic
1016330757 6:142949656-142949678 GAGAGGATTTGGAGGAAGAATGG + Intergenic
1017755518 6:157525983-157526005 CAGTGGAGTAGGAAGAAGTTTGG - Intronic
1018777781 6:167034226-167034248 CTGTGGATTAAGAGGGATCAGGG + Intronic
1020044876 7:5033292-5033314 CAGTGGATTCGAATGATGCAAGG + Intronic
1020459442 7:8412451-8412473 CAATGGAGAAGGATGAAGCAAGG + Intergenic
1021822846 7:24515434-24515456 CAGTGGAATAGAAAGAACCAAGG + Intergenic
1021823260 7:24519076-24519098 CAGTGGAATAGAAAGAACCAAGG - Intergenic
1022129813 7:27394707-27394729 CAGAGGATCAGGCAGAAGCAAGG - Intergenic
1022297222 7:29067423-29067445 CAATGCTTTAGGAGGAGGCAGGG + Intronic
1023340504 7:39214321-39214343 CAGGGGAGGAGGAGGAAGGAAGG - Intronic
1025605771 7:63038942-63038964 CAGTGGAGTAGGAGGAGGAAAGG + Intergenic
1026506987 7:70993334-70993356 CAGAGGCTTTGGAGGAAGAATGG - Intergenic
1027996733 7:85434428-85434450 CAGAGGTTTAGGAGGAATAATGG + Intergenic
1029746988 7:102521460-102521482 CAGGGGATGAGGAGGAAGTTGGG + Intergenic
1029764941 7:102620549-102620571 CAGGGGATGAGGAGGAAGTTGGG + Intronic
1029943022 7:104500277-104500299 CAGTTGATTAGAAGGAATCACGG - Intronic
1031272127 7:119665335-119665357 CAGTGGGTTATGAGGATGTAAGG + Intergenic
1033017105 7:137682556-137682578 CTGTGGATTGGGAGGAAGAAGGG - Intronic
1033969678 7:147024772-147024794 CAGTGGATGAAGAGGAATCATGG + Intronic
1035158026 7:156930031-156930053 CAGAGGATGAGGAGGAACCAGGG - Intergenic
1036779177 8:11634042-11634064 CAGTGGAGTAGGAGGAGGAGAGG - Intergenic
1038636786 8:29293636-29293658 CAGTGGACTAGGTGGGGGCAGGG + Intergenic
1039652102 8:39353354-39353376 CAGAGGACTAGGAGGAAAAATGG + Intergenic
1040482281 8:47836965-47836987 CTGTGGATTGGGAGGAATGAGGG + Intronic
1041552077 8:59114096-59114118 CAGTGGAACAGGAAGAAGTAGGG - Intronic
1043655900 8:82664363-82664385 CAGTGTAGTAGAAGGAGGCAGGG - Intergenic
1044115259 8:88327542-88327564 CAGTGCAGGAGGAGGACGCACGG - Intronic
1044587742 8:93883820-93883842 GAGTGGATGTGGAGGCAGCAAGG - Intronic
1045705576 8:104918702-104918724 CAGTGGATTGGTAGGCAGCAGGG + Intronic
1046810199 8:118524903-118524925 CAGGGGAAAAGCAGGAAGCAGGG - Intronic
1048601875 8:135927073-135927095 TAGTGAATTAGGAGGTAGCATGG + Intergenic
1049043441 8:140129952-140129974 CTGTGGCTTCGGAGGAATCAGGG + Intronic
1049542124 8:143213399-143213421 CAGGGGCTTAGGAAGAAGGAGGG + Intergenic
1049621565 8:143600593-143600615 CTGTGGCTGATGAGGAAGCAGGG - Exonic
1050031245 9:1388627-1388649 TACGGGATAAGGAGGAAGCAGGG - Intergenic
1050292132 9:4165951-4165973 CAGGGGAGTAGGAGGGAGCTGGG + Intronic
1050351197 9:4741874-4741896 CAGAGGAGGAGGAGGAAGGAGGG - Intronic
1051349967 9:16189972-16189994 CAGTGCAATAGCAGAAAGCATGG - Intergenic
1054877200 9:70109240-70109262 CAGTGGTTGAGGATGGAGCATGG + Intronic
1055899092 9:81213888-81213910 CAGGAGGTTAGGAGGAAGAAAGG - Intergenic
1056053847 9:82799989-82800011 CAGGAGCTTTGGAGGAAGCAGGG + Intergenic
1056238994 9:84624682-84624704 CTGTGTATTTGGAGGAAGGAGGG - Intergenic
1057250823 9:93500259-93500281 CAGATGATGGGGAGGAAGCAAGG - Intronic
1058695600 9:107556619-107556641 CTGAGGAGGAGGAGGAAGCAGGG - Intergenic
1061733630 9:132636788-132636810 CAGTGAATAAGGAGAAAGAAAGG + Intronic
1062060952 9:134494730-134494752 CAGGGGATTTGGACGAAGCCAGG - Intergenic
1187188042 X:17006439-17006461 CAGAAGAGTTGGAGGAAGCAAGG - Intronic
1188069865 X:25705560-25705582 CAGAGGACTAGGAGGAAAAATGG + Intergenic
1188148028 X:26638491-26638513 CAGAAGGTGAGGAGGAAGCAAGG + Intergenic
1189248657 X:39582717-39582739 TAGAGGCTTTGGAGGAAGCATGG - Intergenic
1189746091 X:44170428-44170450 CAGAGGAGGAGGAGGAGGCAGGG + Intronic
1189892436 X:45618142-45618164 CAGAAGATGAAGAGGAAGCAAGG - Intergenic
1190254416 X:48751885-48751907 CAGTGGATGGGGAAGAAGCACGG + Intergenic
1190512873 X:51192029-51192051 GAGAGGATTATGAGGAAGCCTGG - Intergenic
1193423302 X:81310290-81310312 CAGTGGATTTTGAGGACTCAGGG - Intergenic
1193446932 X:81616958-81616980 AATTGGATTTCGAGGAAGCAGGG + Intergenic
1195446863 X:104962141-104962163 TAGTGAATTAGGAGAAAGCAAGG - Intronic
1195762474 X:108261706-108261728 CACTGGATCAAGAGGAGGCAGGG + Intronic
1196108998 X:111926117-111926139 CAGTGGAGCAGGGGGAGGCAGGG + Intronic
1196403211 X:115337517-115337539 CAGGAAATTAGGAGAAAGCAGGG + Intergenic
1196750450 X:119112141-119112163 CAGAGGATAAAGGGGAAGCAAGG - Intronic
1198161282 X:134011166-134011188 CAGTGAATTATGTGGAGGCAGGG - Intergenic
1199155814 X:144547809-144547831 CACTGCATTAGGAGCAGGCATGG - Intergenic
1200571764 Y:4840886-4840908 CAGAAGATGAGGGGGAAGCAAGG + Intergenic
1201724325 Y:17136579-17136601 CACTTGATTAGGATGAACCAGGG + Intergenic
1202379046 Y:24260585-24260607 CAGGGGAGTAGAAGGAAGAAAGG + Intergenic
1202491736 Y:25409536-25409558 CAGGGGAGTAGAAGGAAGAAAGG - Intergenic