ID: 926905233

View in Genome Browser
Species Human (GRCh38)
Location 2:17799405-17799427
Sequence CACCCTCAGCTGCCCAGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 397}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926905233_926905235 -10 Left 926905233 2:17799405-17799427 CCAGTGCTGGGCAGCTGAGGGTG 0: 1
1: 0
2: 2
3: 38
4: 397
Right 926905235 2:17799418-17799440 GCTGAGGGTGATCAGCAGAAGGG 0: 1
1: 0
2: 2
3: 14
4: 255
926905233_926905241 30 Left 926905233 2:17799405-17799427 CCAGTGCTGGGCAGCTGAGGGTG 0: 1
1: 0
2: 2
3: 38
4: 397
Right 926905241 2:17799458-17799480 CCCTGCTTCTAGTCTAATTGAGG 0: 1
1: 0
2: 0
3: 11
4: 90
926905233_926905236 -6 Left 926905233 2:17799405-17799427 CCAGTGCTGGGCAGCTGAGGGTG 0: 1
1: 0
2: 2
3: 38
4: 397
Right 926905236 2:17799422-17799444 AGGGTGATCAGCAGAAGGGCAGG 0: 1
1: 0
2: 1
3: 39
4: 647

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926905233 Original CRISPR CACCCTCAGCTGCCCAGCAC TGG (reversed) Intronic
900399533 1:2467357-2467379 AACCCTTGGCTGCCCAGCCCGGG - Intronic
900403742 1:2483569-2483591 CACCCTGCCCTGCCCAGCCCTGG + Intronic
900507537 1:3037203-3037225 CACCCACCCCTCCCCAGCACAGG + Intergenic
900612676 1:3550969-3550991 CACAGGCAGCTGCCCAGCCCTGG - Intronic
900782119 1:4625073-4625095 CAGTCTCTGCTGCCCAGCCCAGG - Intergenic
900919909 1:5663465-5663487 GACCCTCTGCTGCCCTGCCCTGG + Intergenic
901039700 1:6356480-6356502 CACCCACACCTGGCCAGCCCTGG + Intronic
901658518 1:10784367-10784389 CCACCTGAGCTGCCCAGCACAGG + Intronic
901823906 1:11848118-11848140 CACCCTCTGTTTCCCCGCACGGG - Intronic
901863879 1:12091380-12091402 CACCCTCAGCTGTTCTGCACTGG - Intronic
902308892 1:15565243-15565265 GAACCTCTGGTGCCCAGCACAGG + Intronic
902451405 1:16499059-16499081 CGCCCGCCGCTGCCCGGCACCGG - Intergenic
902472505 1:16658448-16658470 CACCCACCGCTGCCCGGCACCGG - Intergenic
902486300 1:16748998-16749020 CACCCACCGCTGCCCGGCACTGG + Intronic
902864547 1:19269521-19269543 GACCCACAGATGCCCAGCCCAGG - Intergenic
902866770 1:19284956-19284978 GACCCACAGATGCCCAGCCCAGG - Intronic
903336687 1:22629106-22629128 CTCCCTCATCTGCCCATCACAGG - Intergenic
904289088 1:29472006-29472028 AACCCTCCCCTTCCCAGCACAGG - Intergenic
904415449 1:30358745-30358767 AACCCTCTCCTTCCCAGCACAGG + Intergenic
905927604 1:41762965-41762987 CAGGCTCAGCTGCCCAGACCTGG - Intronic
906344343 1:45005914-45005936 CACCCTGAGCTGCCCAGGTTTGG + Intronic
908988688 1:70057877-70057899 CACTCTCAGGTGCACAGGACAGG - Intronic
909572564 1:77133623-77133645 CACTCTTAACTGCCCAGCAGAGG - Intronic
910237153 1:85048134-85048156 CACCCCCACCCGCCCAGCCCCGG + Intronic
912631875 1:111253352-111253374 CACCATCAGCTTCTCAGCAGAGG - Intergenic
912648563 1:111418233-111418255 CACCCTCTGCTGCTCATCCCAGG + Intronic
912725566 1:112056466-112056488 TTCCCTCAGCTGCCCTGCAAAGG + Intergenic
914916116 1:151820199-151820221 CACCCTCATGTACACAGCACTGG - Intronic
915302842 1:154961494-154961516 CCCCCTGCGCCGCCCAGCACCGG - Exonic
915479740 1:156176577-156176599 CATTCTCAGTTGCCCAGCACTGG - Exonic
916128745 1:161593275-161593297 CACCCCCAGCTCCCCTGCTCAGG - Intronic
916849985 1:168693979-168694001 TCCCCTCATCTGCCCAGTACAGG - Intergenic
917450918 1:175146724-175146746 TAACCCCAGCTGCCCAGCAGAGG + Intronic
919477098 1:198042441-198042463 CCCGCTCAGCAGCCCAGCTCAGG + Intergenic
920395790 1:205644930-205644952 CAACCTCAGCTCCCCACCCCAGG - Intergenic
920705532 1:208248010-208248032 CACCCTTGGCTCCCAAGCACAGG - Intergenic
920953918 1:210599958-210599980 TAGCCTCAGCTCCCCAACACAGG + Intronic
922758478 1:228109600-228109622 CTCCCTCAGCTCCCCACCCCGGG - Intergenic
924007721 1:239630796-239630818 CAACCTCAGTTTCCCAGCCCAGG + Intronic
924471654 1:244348287-244348309 CACTCCCAGCTGGCCAGTACAGG + Intergenic
1064217189 10:13410153-13410175 CACCCCCAGCGCCCCAGCATGGG - Intergenic
1065156404 10:22874313-22874335 CACCCTCAGCTGCGCTTCAGAGG - Intergenic
1066447935 10:35500808-35500830 CAGGCTGAGCTGCTCAGCACAGG + Intronic
1067042280 10:42961389-42961411 CAGGCTCAGCTCCACAGCACAGG + Intergenic
1069890070 10:71647023-71647045 CACCCCCAGCTGCCCATGGCTGG + Intronic
1069898935 10:71695969-71695991 CCCCCACGGCTGCCCAGCAGGGG + Intronic
1069943542 10:71971111-71971133 GACCCTCCGCTGCCAAGCCCTGG - Intronic
1070511491 10:77165114-77165136 CACTTTCAGCTGCCTAGCAGAGG - Intronic
1072614743 10:97042151-97042173 CACCCTCAGCTGGCCTGGCCAGG - Intronic
1072637720 10:97188205-97188227 CTCCCCCAGCAGCCCATCACAGG + Intronic
1073512498 10:104051578-104051600 AACCCCCACCTGCCCTGCACCGG - Intronic
1074107782 10:110401519-110401541 CCCTCTCACCTTCCCAGCACAGG - Intergenic
1075522807 10:123154284-123154306 TCCGCTCAGCTGCCCAGCATCGG - Exonic
1076377804 10:130003237-130003259 CACCCTCAGAGTCCCAGCACAGG - Intergenic
1077170693 11:1164660-1164682 CAGCCTCAGCGGCCCAGGACAGG - Intronic
1077170744 11:1164822-1164844 CAGCCTCAGGGGCCCAGGACAGG - Intronic
1077170824 11:1165049-1165071 CAGCCTCAGGGGCCCAGGACAGG - Intronic
1077215953 11:1395208-1395230 ACCCCTCATCTGCCCTGCACGGG + Intronic
1077358187 11:2128221-2128243 CACCCTCCAGTGCCCGGCACAGG + Intergenic
1077474684 11:2780721-2780743 CAAGCTCAGCTGGCCTGCACTGG - Intronic
1077657088 11:4029694-4029716 CACCCTGAGCTGCCGAGGATAGG + Intronic
1079135921 11:17775936-17775958 CAGCCACTGCTGCCCAGCAGGGG - Intronic
1079859668 11:25652308-25652330 CTCCATAAGCTGCCCACCACAGG + Intergenic
1080663338 11:34314886-34314908 CACCCTCAGCCTCTCAGAACAGG - Intronic
1080873751 11:36258898-36258920 CGCCATCAGCTGCCCAGTCCCGG - Intergenic
1081703349 11:45165507-45165529 CACACTCAGATGCCCAGCCCAGG + Intronic
1081979026 11:47254727-47254749 CACACTCTGCTCCCCAGCCCCGG + Intronic
1083272732 11:61580430-61580452 CACCCGAGGCTCCCCAGCACCGG - Intronic
1083437899 11:62655384-62655406 CTCCCACAGCTTCCCAGCATAGG + Intronic
1083929411 11:65832441-65832463 CAACCTCAGCTTCTCATCACTGG + Intronic
1083929420 11:65832546-65832568 CAACCTCAGCTTCTCATCACTGG + Intronic
1083929427 11:65832630-65832652 CAACCTCAGCTTCTCATCACTGG + Intronic
1085040562 11:73324109-73324131 CCCCCTCAGCTTCCCAGCCCAGG + Intronic
1086703152 11:89922624-89922646 GACCCTCAGCTGCCGACCAGTGG - Intergenic
1086733926 11:90282916-90282938 CACCCTGAGCAGCTCATCACAGG + Intergenic
1088048157 11:105478778-105478800 CAACCTCCACTGCCCAGCTCTGG + Intergenic
1088882770 11:113984499-113984521 CACCTTTAGATCCCCAGCACAGG + Intronic
1089363416 11:117906031-117906053 GACCCTCAGCTGCCCAGTATCGG - Intronic
1089381774 11:118037997-118038019 CACCCTCAGCCCCACAGCAAGGG - Intergenic
1090387807 11:126366675-126366697 AACCCTCAGCTGCACAGGTCTGG + Intronic
1092669878 12:10851000-10851022 GACCTTCATCTGCACAGCACAGG - Intronic
1092673137 12:10885868-10885890 GACCCTCATATGCCCAGCACAGG - Intronic
1092712960 12:11357137-11357159 GACCCTCATGTGCACAGCACAGG - Intronic
1092716752 12:11397107-11397129 GACCCTCATGTGCACAGCACAGG - Intronic
1092900676 12:13056810-13056832 CATCCTCCTCTGCCCAGCAAAGG + Intronic
1096127291 12:49129333-49129355 CACCCTGAGCAGCTCATCACAGG - Exonic
1096470120 12:51870292-51870314 CACCCACAGCTTCCCTGCAAAGG + Intergenic
1098290955 12:68956340-68956362 CAGCTGCAGCTGCCCAGCCCTGG - Intronic
1098326665 12:69310445-69310467 CACACTCTGTTGCCCAGCAGTGG - Intergenic
1100687364 12:97001832-97001854 CATTCTCAGCAGACCAGCACAGG - Intergenic
1102497751 12:113331095-113331117 CACCCTCAGCTGATCAGGCCAGG + Intronic
1103597931 12:122035447-122035469 CAGCCTCTCCTGCCCAGCCCGGG + Intronic
1103946311 12:124528643-124528665 CACCCTCATCTCTCCAGCAGAGG + Intronic
1104485694 12:129149736-129149758 CAGCTTGAGCTGCCCAACACTGG + Intronic
1104599487 12:130142824-130142846 CACCCTCAGCTACCCTGGGCCGG + Intergenic
1104627046 12:130366081-130366103 AACCCTCTGCTTCCCAGCATTGG + Intronic
1104943422 12:132405236-132405258 CTCCCTCAGCTGCCCTGGTCTGG + Intergenic
1105357263 13:19669891-19669913 CACCCAAAGATGCCCACCACAGG + Intronic
1105378156 13:19863499-19863521 CACTCTCAGCGGCCCTGGACTGG + Exonic
1105891248 13:24684019-24684041 TGCCCTCTGCTGGCCAGCACTGG - Intronic
1107676088 13:42798663-42798685 CAGCCACAGCTTCCCAGCATTGG - Intergenic
1107758732 13:43653080-43653102 TGCCCTCAGTTGCGCAGCACAGG + Intronic
1112329679 13:98467700-98467722 CACCTCCTTCTGCCCAGCACAGG + Intronic
1112427090 13:99312538-99312560 CACGGTAAGATGCCCAGCACAGG - Intronic
1112434663 13:99383483-99383505 CATGCTCAGCTGCCCAGGGCTGG - Intronic
1113074069 13:106451056-106451078 CACACTCAGATGCAAAGCACAGG - Intergenic
1116167230 14:41349712-41349734 CACTCTCAGCCTCCCAGCCCCGG - Intergenic
1116848120 14:49883325-49883347 CAACCTCAGCCTCCCAGCAAGGG - Intergenic
1117288201 14:54307749-54307771 CACGACCAGCTGCCTAGCACAGG + Intergenic
1117298470 14:54399515-54399537 CACCTTCATTTGCCAAGCACTGG - Intronic
1117567509 14:57010077-57010099 CACCCCTAGCTGCCCAGCCAAGG + Intergenic
1118039741 14:61903863-61903885 CACCTTCAGCATCCCAGCAGTGG - Intergenic
1118507250 14:66426857-66426879 CACCCTGATCTACACAGCACAGG + Intergenic
1119765177 14:77183295-77183317 CAGCCTCAGCTTCTCAGCGCTGG - Intronic
1119780645 14:77274799-77274821 CAGGCTCACCTGCCCAGCCCAGG + Intergenic
1119853498 14:77882730-77882752 CACACTGAGCAGCCAAGCACTGG - Intronic
1119989651 14:79181649-79181671 CACACTCTGTTGCCCAGGACTGG - Intronic
1120317369 14:82912876-82912898 CAGCCTCAGGTACTCAGCACCGG + Intergenic
1121287008 14:92743769-92743791 CTCCCTCTGCTGCCCAGCTTAGG - Intronic
1122829915 14:104390841-104390863 CATCCTCAGGTGCCCAGTCCAGG - Intergenic
1123438283 15:20271810-20271832 TGCCCTCAGCAGCCCAGCTCAGG + Intergenic
1124940070 15:34209897-34209919 CGCCCGCAGCTGCCCTGCCCTGG - Intronic
1125009027 15:34850118-34850140 CACCCTGAGCAGCTCATCACAGG - Intergenic
1125605384 15:40937270-40937292 CCCCTGCAGCAGCCCAGCACTGG + Intronic
1125932091 15:43607655-43607677 CACCCTCAGCTGCCCTGTGCTGG + Intronic
1125945190 15:43707129-43707151 CACCCTCAGCTGCCCTGTGCTGG + Intergenic
1128237328 15:66077195-66077217 CACACTGACCTGCTCAGCACTGG + Intronic
1128717870 15:69921887-69921909 CAACCTCAGCTGATCAGCTCAGG - Intergenic
1128759019 15:70202703-70202725 CAGCCAGAGCTGCCCAGAACAGG - Intergenic
1128772974 15:70296381-70296403 CACCCTGAGTTGCCCAGGACAGG - Intergenic
1129003154 15:72350611-72350633 CACCCACATCTACACAGCACAGG - Exonic
1129172465 15:73816581-73816603 CATCCTTTCCTGCCCAGCACTGG - Intergenic
1129712418 15:77827092-77827114 CTCCCTGAGCTGTCCAGCTCTGG + Intergenic
1130680809 15:85994764-85994786 CACTCTCAGCAAACCAGCACAGG - Intergenic
1131096059 15:89655044-89655066 CAGCCCCAGCTGCCCTGCCCCGG - Intronic
1132662710 16:1068773-1068795 CCCCCTGCCCTGCCCAGCACAGG + Intergenic
1132880733 16:2160707-2160729 CACCCCCACTTCCCCAGCACTGG + Intronic
1133210714 16:4262024-4262046 CCCCCAAAGCTGCCCAACACAGG + Intronic
1133567171 16:7006820-7006842 AACCCTCAGCTCCCAAGCAGTGG + Intronic
1134121131 16:11586133-11586155 CACCAGCACCTACCCAGCACCGG + Intronic
1135149336 16:19991906-19991928 CACTCACAGCTGCCCAGGAGAGG - Intergenic
1135640823 16:24118483-24118505 CACTCCCAGCTACCCAGCAGTGG - Intronic
1136417769 16:30113989-30114011 CACTCCCAGCTGCCCAGGGCTGG - Intergenic
1136625950 16:31462362-31462384 CAGACTTAGCTGCTCAGCACAGG - Exonic
1138578879 16:57926643-57926665 CATCCTCCTGTGCCCAGCACAGG + Intronic
1139118230 16:63983215-63983237 CACCTTCACCTGCTCAGCAGTGG - Intergenic
1139171836 16:64639930-64639952 CATCCTCAGCAAACCAGCACAGG - Intergenic
1139559218 16:67730998-67731020 TACCCTCTGCTCCCCACCACTGG - Intronic
1140878003 16:79171093-79171115 CACTCTCACGTGCCTAGCACTGG - Intronic
1141789890 16:86227250-86227272 CAACTTCAGCTCCACAGCACCGG - Intergenic
1142262674 16:89050192-89050214 CACCCTCAGCTGCTCTGACCCGG - Intergenic
1143037404 17:4007308-4007330 CTCCCTCTGGTCCCCAGCACTGG - Intronic
1143124928 17:4635949-4635971 CAGCTCCAGCTGCCCCGCACAGG - Exonic
1143403585 17:6661201-6661223 CAGCTCCAGCTGCCCAGCACAGG + Intergenic
1143870897 17:9956734-9956756 CACCCTTTGCTGCCCAGGCCTGG + Intronic
1144773938 17:17774763-17774785 CGCCCTCCTCTGCCCAGCATTGG + Intronic
1144789638 17:17850214-17850236 CACTCTCAGCAGCCCAGTAGGGG - Intronic
1145759979 17:27420392-27420414 CACCGTGAGATGCCCAGAACTGG - Intergenic
1146052654 17:29566155-29566177 CACTCTCGGCAGCGCAGCACGGG + Exonic
1146793459 17:35765749-35765771 CACACACAGCTGCCTAGCCCTGG + Intronic
1146844436 17:36174179-36174201 CACCGTGAGATGCCCAGAACGGG + Intronic
1146856740 17:36262114-36262136 CACCGTGAGATGCCCAGAACGGG + Intronic
1146863877 17:36326261-36326283 CACCGTGAGATGCCCAGAACGGG - Intronic
1146872650 17:36386025-36386047 CACCGTGAGATGCCCAGAACGGG + Intronic
1146880009 17:36437110-36437132 CACCGTGAGATGCCCAGAACGGG + Intronic
1147066736 17:37926849-37926871 CACCGTGAGATGCCCAGAACGGG - Intronic
1147075535 17:37986649-37986671 CACCGTGAGATGCCCAGAACGGG + Intronic
1147078268 17:38006410-38006432 CACCGTGAGATGCCCAGAACGGG - Intronic
1147087060 17:38066195-38066217 CACCGTGAGATGCCCAGAACGGG + Intronic
1147094206 17:38130345-38130367 CACCGTGAGATGCCCAGAACGGG - Intergenic
1147103005 17:38190158-38190180 CACCGTGAGATGCCCAGAACGGG + Intergenic
1147342523 17:39762233-39762255 CACCCTCACCTCCCCAGCCCTGG + Intergenic
1148753087 17:49957129-49957151 CACCCTCAGCTTCTAAGCACAGG - Intergenic
1149847578 17:60016625-60016647 CACCGTGAGATGCCCAGAACGGG + Intergenic
1150226413 17:63527039-63527061 CACCCACGCCTGCCCCGCACTGG + Intronic
1150289235 17:63972100-63972122 CTCCCTGAGCTCCCCAGCCCTGG - Intronic
1150587504 17:66532049-66532071 CACCCTGATCTGCTCAGCAGTGG - Intronic
1150621768 17:66812891-66812913 CATCCTCACATGCCCAGCTCTGG + Intergenic
1151381387 17:73728085-73728107 CAGCCTCACCTGCTCAGCACCGG - Intergenic
1151458658 17:74241814-74241836 CTCCCGCTGGTGCCCAGCACAGG + Intronic
1151476071 17:74344968-74344990 CTCCCTCCTCTGCCCAGCCCAGG - Intronic
1151493090 17:74444114-74444136 CACCTTCAGCTGCACTGCAGTGG + Intronic
1151599256 17:75096292-75096314 CACCCTCAGCTATGCAGCTCTGG + Intronic
1151767011 17:76137890-76137912 CACCGTCAGCGGCCCGGCCCGGG + Exonic
1151825034 17:76519330-76519352 CTCCCTCAGCTGCCCCTCCCTGG + Intergenic
1152296401 17:79469636-79469658 CACCCACAGCTGCACACAACTGG + Intronic
1152314733 17:79573541-79573563 CACCCTGACTTCCCCAGCACGGG + Intergenic
1152407050 17:80103813-80103835 CACCCTCAGCTGCGGTGCCCAGG + Intergenic
1152613725 17:81328585-81328607 CCCACACTGCTGCCCAGCACGGG - Intronic
1152879289 17:82806265-82806287 CACACCCAGCTGCCCAGAACAGG - Intronic
1153665094 18:7360965-7360987 CACCCCCTGCTTCGCAGCACCGG + Intergenic
1153810488 18:8747876-8747898 TAGCCTCAGCAGCCCTGCACAGG + Intronic
1154147010 18:11874857-11874879 CGCCCTCCCCTGCCCATCACTGG + Intronic
1155351471 18:24911622-24911644 TACCCTCCTCTGCCCAGAACTGG - Intergenic
1160066845 18:75583379-75583401 CCCCCTCACCTACCCAGGACTGG - Intergenic
1160103629 18:75947777-75947799 CAGCCTCAGCTGGGCAGGACTGG + Intergenic
1160302705 18:77700193-77700215 CACCCACAGCTCCCCTGCGCTGG - Intergenic
1160589392 18:79934585-79934607 CACCCTCCAGGGCCCAGCACTGG + Intronic
1160623650 18:80188457-80188479 CAACTTCTGCTGCCCAGGACGGG - Intronic
1163289535 19:16370388-16370410 CTCCCTCAGGTGCCAAGCAAGGG + Intronic
1164608854 19:29618677-29618699 CACCCACAGCTGCCTAGAGCCGG - Intergenic
1164861014 19:31562290-31562312 CACCCTCATCCGCCAAGCAAAGG + Intergenic
1165363338 19:35350154-35350176 CAGCCTCTGCTGACCAGCACTGG - Intergenic
1165730481 19:38141634-38141656 AACCCAGAGCTCCCCAGCACTGG - Intronic
1166077350 19:40421331-40421353 CACACTCAGCGGCCTGGCACGGG - Intergenic
1166190564 19:41173872-41173894 CACCCCCAGCTGTCCATCGCCGG - Intergenic
1166198599 19:41221938-41221960 CAACCTGAGCTGCCAAGCTCAGG + Exonic
1166301321 19:41913486-41913508 GACCCGCAGCCGCCCAGGACGGG + Intronic
1166662868 19:44658582-44658604 CACCCTCTGGTGCCCAGAATGGG - Intronic
1166740808 19:45113814-45113836 CACCATCAGGTGCCCAGCCCTGG + Intronic
1167386788 19:49168325-49168347 GACCATCAGATGGCCAGCACTGG + Exonic
1167745175 19:51346635-51346657 CACCTTCTGCTGCCCAGCGAAGG + Intronic
1167814737 19:51869820-51869842 AAACCTCAACTGCCCAGCACAGG + Intronic
1168134090 19:54338790-54338812 CACCCCCAGCTGCCCAGGGGTGG + Intronic
1202704896 1_KI270713v1_random:15253-15275 CACCCACCGCTGCCCGGCACCGG - Intergenic
926044989 2:9703758-9703780 AGACCTCAGCTGCCCAGCAGTGG + Intergenic
926098070 2:10095516-10095538 GAGTTTCAGCTGCCCAGCACAGG + Intergenic
926142064 2:10373730-10373752 CCCCCACAGCAGCCCAGCCCAGG + Intronic
926272237 2:11375403-11375425 CAAGCTCAGCTGCCCAGGCCTGG - Intergenic
926905233 2:17799405-17799427 CACCCTCAGCTGCCCAGCACTGG - Intronic
927148957 2:20184943-20184965 CCCCCACAGCAGCCCAGCATGGG + Intergenic
927513422 2:23658468-23658490 ACCCCCCAGCTGCTCAGCACAGG + Intronic
927847172 2:26477564-26477586 CTTCCTCATCTGCCCAGCCCTGG + Intronic
928680775 2:33700153-33700175 CAGCCTCAGCTGCCCAACCAGGG + Intergenic
931117459 2:59180211-59180233 CACCCTCTCCTCCTCAGCACTGG - Intergenic
932106108 2:68944203-68944225 CAGCCTCAGCTGCTCAGCATGGG - Intergenic
932513988 2:72326019-72326041 CACTCTCTGCTGCCCTCCACCGG + Intronic
932780560 2:74556104-74556126 CTCCCACAGCTGCCCAACCCAGG - Intronic
932977770 2:76625054-76625076 CAGCCTCTGCTGCCCAGCCAGGG - Intergenic
934119898 2:88828684-88828706 CATCCTCAGTTACCCAGCAGGGG + Intergenic
934561539 2:95316043-95316065 CCCCCACAGCAGCCCAGCAGTGG + Intronic
934938278 2:98480860-98480882 CACCCTCCACAGGCCAGCACAGG - Intronic
935061113 2:99608615-99608637 GACCCTCAGCTCCCCAGCCGAGG + Intronic
936060848 2:109294832-109294854 CACCCCAAGATGCCCAGCTCTGG - Intronic
936062231 2:109302558-109302580 CACTGTCAGCAGCACAGCACAGG - Intronic
937359423 2:121218655-121218677 TCCCATCAGCTGCCCTGCACAGG + Exonic
938307505 2:130265534-130265556 CACCCTCATCTGCCCAGCCTTGG - Intergenic
938447827 2:131391308-131391330 CACCCTCATCTGCCCAGCCTTGG + Intergenic
939035249 2:137122995-137123017 TACTCTCATCTTCCCAGCACTGG + Intronic
941554860 2:166965016-166965038 CATCATCAGTTGCCCACCACAGG + Intronic
941979018 2:171434499-171434521 CAGCGGCGGCTGCCCAGCACGGG + Exonic
945037665 2:205717776-205717798 CATCCTCTGCTGCCGAGCAGTGG + Intronic
945258869 2:207825776-207825798 CACCATCAGCTACCCAGAGCTGG - Intergenic
946027218 2:216679139-216679161 CACCCCAAACTGCCCAGCCCTGG - Intronic
946373746 2:219296249-219296271 CACCCTCATCTGGCCAGTAGCGG + Exonic
947642237 2:231713659-231713681 CAGACTCTGCTGCCCATCACAGG - Intergenic
948659028 2:239495410-239495432 CACTCTCTGCAGCCCTGCACAGG - Intergenic
948665806 2:239534160-239534182 CACCCTGAGCTGAGCAGCTCTGG - Intergenic
948831572 2:240600912-240600934 CACCATCAGGCGCCCTGCACAGG - Intronic
1169090781 20:2860262-2860284 CCTCCTCAGCTGACCAGCCCAGG - Exonic
1169112789 20:3044470-3044492 GACCCTCAGAGGCTCAGCACTGG + Exonic
1169341390 20:4799196-4799218 CCCCCTCTGAAGCCCAGCACTGG + Intronic
1169341653 20:4800908-4800930 CACCCACAACATCCCAGCACGGG + Intronic
1170429959 20:16266814-16266836 GACCCTCAGATGCCCAGCTGCGG - Intergenic
1170604648 20:17866449-17866471 CATCCGCAGCTGCACACCACAGG + Intergenic
1170609686 20:17902425-17902447 CAACCTCAGCTGCACAGCACAGG + Intergenic
1170738034 20:19027494-19027516 CACTCTCAGCTGGCCTGGACTGG - Intergenic
1171044306 20:21796246-21796268 CAGCCCCAGGTGCCCAGCAGAGG + Intergenic
1171173593 20:23035450-23035472 CGCGCTCAGCTGCCCTGCGCCGG + Exonic
1171183941 20:23111566-23111588 CTCTCCCAGCTGCCCTGCACGGG + Intergenic
1172052373 20:32128118-32128140 TCCCCTCAGCTGTGCAGCACTGG - Intronic
1172086936 20:32392573-32392595 CCGCCTCAGCCTCCCAGCACAGG - Intronic
1172274655 20:33673199-33673221 CACCCAAAGCAGCCCAGCAAAGG + Intronic
1172289614 20:33766686-33766708 CACACTCAGCTGCTGTGCACTGG - Intronic
1172933861 20:38605159-38605181 TACCCACAGCTCTCCAGCACTGG + Intronic
1173123740 20:40317654-40317676 CTCCCTGACCTGCCCAGAACAGG + Intergenic
1175218009 20:57401530-57401552 CTGCCTCAGATGCTCAGCACTGG + Intronic
1175227140 20:57451258-57451280 CACCCGCAGCTAGCCAGCCCCGG + Intergenic
1175485648 20:59344062-59344084 CACCCTCTGCAGCCCAGTCCAGG - Intergenic
1175916835 20:62429952-62429974 CACCCTCATCAGCCCTGCAAGGG - Intergenic
1175921759 20:62453483-62453505 CACCCTCACATGCCCAGGCCAGG - Intergenic
1176003257 20:62844176-62844198 CACCCCCAGCGGCAAAGCACAGG + Intronic
1176031997 20:63017241-63017263 CACCCTGCACAGCCCAGCACTGG - Intergenic
1176131648 20:63498971-63498993 CACCCTCTGCCCCCCAGGACCGG + Intronic
1179190078 21:39115993-39116015 CAGGCTCAACAGCCCAGCACTGG + Intergenic
1179247444 21:39645952-39645974 CGCCCTCTGCCTCCCAGCACAGG + Intronic
1179641608 21:42751312-42751334 CACCGTCAGCGGCCCAGGGCTGG - Intronic
1179722603 21:43324152-43324174 CACCCTCAGCTCCCCATCCCAGG + Intergenic
1179795115 21:43778083-43778105 CACCAACAGGTGCCTAGCACAGG - Intergenic
1179928315 21:44550560-44550582 CAGCCACAGCCGCCCAGCCCCGG - Exonic
1179939365 21:44628159-44628181 CAGCCACAGCCGCCCAGCCCCGG + Exonic
1180004762 21:45015254-45015276 TGCCCTGAGCTGCCCAGCTCTGG + Intergenic
1181171429 22:21012338-21012360 CAGCATCAGCTGCACAGCAGAGG + Intronic
1182903676 22:33919852-33919874 CACCCTCTGCTGCCCCGGCCGGG - Intronic
1184877754 22:47286280-47286302 CACCAGCAGGTGTCCAGCACAGG - Intergenic
1185302237 22:50087948-50087970 GCCCCTCAGCTCCCCAGCTCGGG - Intergenic
950040854 3:9918228-9918250 CAGCCCCTGCTTCCCAGCACTGG + Intronic
950262892 3:11554973-11554995 CCCCCTCTGCTGCCCAGGAGTGG + Exonic
950636335 3:14317785-14317807 CACTCTCTGCTGCCCGGGACTGG + Intergenic
951509752 3:23487344-23487366 CAGCTGCAGCTGCCCAGCAGTGG - Intronic
953849882 3:46457441-46457463 CACCCTCAGCTGCCTACCCAAGG - Intronic
953971200 3:47348501-47348523 TCCTCTCAGCTGCCCAGCAGCGG + Intergenic
954581957 3:51707696-51707718 CCCCCTCAGCTCCCCAGGGCAGG - Intronic
954714666 3:52521100-52521122 CACCCAGAGCTCCCCAGCCCTGG - Intronic
954863388 3:53708878-53708900 CACCCTAAGATGCCCAACACAGG + Intronic
955436886 3:58909999-58910021 CATCCTCAGCTAACTAGCACAGG - Intronic
956588110 3:70885217-70885239 CACCCTCACCTGCCTGTCACTGG - Intergenic
957255030 3:77825685-77825707 CAGCCTCTGCTGCCCAGCCTGGG - Intergenic
957915477 3:86682814-86682836 CAGCCTCTGCTGCCCAGCTTGGG - Intergenic
958161320 3:89819148-89819170 CAGCTGCAGCTGCCCAGCAGTGG - Intergenic
961670256 3:128523602-128523624 CACCCCCAGCTGGGCAGCGCAGG - Intergenic
962958187 3:140285800-140285822 CACCCTGATTTGCCCAGGACTGG + Intronic
967094952 3:186170041-186170063 CCACTTCAGCTGCCCACCACTGG - Intronic
967127396 3:186436162-186436184 CTCCCTCTGATGCCCAGCAGAGG - Intergenic
968088115 3:195883301-195883323 CACACTCACCTGCCCAGAGCGGG + Exonic
968511668 4:998335-998357 CACCCCCAGCTCCACAGCAAAGG - Intronic
968515822 4:1015254-1015276 CAGCCTCAGCGGGTCAGCACAGG + Intronic
968727691 4:2255892-2255914 CACCCCCAGCTCCCCGGCAGCGG - Intronic
968938528 4:3626000-3626022 CACCCTCAGCAACCAAGCAGGGG - Intergenic
969330610 4:6471938-6471960 CGGCCTCCGCTGCCCAGCGCCGG - Intronic
969660264 4:8523280-8523302 CACCCTCAGCAGCCCTGAGCTGG - Intergenic
971521633 4:27559733-27559755 CTCCCTCAGCTTCCAAGCATTGG - Intergenic
973264446 4:48197609-48197631 CAGCCTCAGCTCCCCATCTCTGG - Intronic
974942854 4:68489708-68489730 CTGCCTCAGCTGCCCAGCCAAGG - Intronic
977293024 4:95183533-95183555 CATCCTCCTCTGCCCAGGACAGG + Intronic
979206692 4:118046565-118046587 CAGCCTCTGCTGCCCAGCCTGGG + Intronic
980009462 4:127579746-127579768 CAGCCTCTGCTGCCCAGCATGGG + Intergenic
981645256 4:146991560-146991582 CAGCCTCAGATGCCCAACAGGGG - Intergenic
984928528 4:184826578-184826600 GGCCCTCAGCTCCCCTGCACCGG - Exonic
985629605 5:1007829-1007851 ACCCCTCACCTGCCCAGCTCCGG - Intergenic
985996276 5:3599049-3599071 CTTCCTGATCTGCCCAGCACAGG + Intronic
986307819 5:6528732-6528754 CACCCTCAGCTTCCCGGGCCAGG + Intergenic
988486992 5:31675411-31675433 TGGCCTCAGCTGCCCAGCTCAGG + Intronic
989604715 5:43232888-43232910 CACCCTGAGCAGCTCATCACAGG - Intronic
990906150 5:60805564-60805586 CACCCTTAGTTACCCAGCCCTGG - Intronic
992169789 5:74090261-74090283 TACCCTCAGGTGAGCAGCACTGG + Intergenic
996265543 5:121535124-121535146 TGGCCTCAGCTGCCCAGCAGAGG + Intergenic
997359887 5:133288359-133288381 CACCCTCAGCAGCACAGCCAGGG + Intronic
997608343 5:135192518-135192540 CACCCTCATTTTACCAGCACAGG + Intronic
997972940 5:138419167-138419189 CACCCTCCTCCGCCCTGCACTGG + Exonic
998140423 5:139696914-139696936 CACCCTCCCCTGCCCACCACAGG - Intergenic
1001318106 5:170658633-170658655 CTTCCTCAGCTGCCCACCACCGG - Intronic
1002065956 5:176651732-176651754 CTGCCTCTGCTGCCCGGCACAGG + Exonic
1002171740 5:177378511-177378533 TTCCTTCAGCTCCCCAGCACTGG - Intergenic
1002376151 5:178790500-178790522 CACCCTGCCCCGCCCAGCACCGG + Intergenic
1003565316 6:7217152-7217174 CACCCTCCCCTGCCCATCTCGGG - Intronic
1003712547 6:8608900-8608922 AATCCTGAGCTGCCCAGCCCAGG + Intergenic
1006029676 6:31170123-31170145 CACCTGCAGCTGCCCAGACCTGG - Intronic
1006034743 6:31202537-31202559 CCCCCACAGCTGCCCAGCCCTGG - Exonic
1006164019 6:32053991-32054013 CACCCTTAGCCTCCCTGCACTGG + Intronic
1006814042 6:36839112-36839134 CACCCGCAGCTGGACAGGACAGG + Intronic
1007114725 6:39335585-39335607 CACCCTCCGCTGCCCCTCCCTGG + Exonic
1008934335 6:56973833-56973855 CAGCCTCAGCTTCCCAGCTCAGG + Intronic
1010393956 6:75369240-75369262 CACCCTCATTTGCCCGGAACTGG - Intronic
1011249201 6:85353186-85353208 AACCCCCAGGTGCCCAGCATTGG - Intergenic
1012125057 6:95418612-95418634 CAGCCTCAGTTGCCAACCACTGG - Intergenic
1012701396 6:102461359-102461381 CACCCTCAGCAGACTAACACAGG + Intergenic
1012944437 6:105450650-105450672 CACCCTCATCTGACCACCCCAGG - Intergenic
1013336135 6:109164496-109164518 CACCCTTAGCTCCTCAGCCCTGG + Intergenic
1013539137 6:111090065-111090087 CACTCTCAGCTACCCAGTATTGG - Intronic
1013883547 6:114934007-114934029 CAGCCTCTGCTGCCCAGCCTGGG - Intergenic
1014157264 6:118125834-118125856 CACTCTCAACTGGCCAGCTCAGG + Intronic
1014426481 6:121313047-121313069 CTGCCTCAGCTCCCCATCACTGG + Intronic
1015683145 6:135830403-135830425 CAGGATCAGATGCCCAGCACAGG - Intergenic
1016157058 6:140823575-140823597 CTCCCTCATCTTCCCAGAACAGG + Intergenic
1016746965 6:147591351-147591373 ATCCCTCACGTGCCCAGCACGGG + Intronic
1017949572 6:159125179-159125201 CCCCCTCTGCTGGCGAGCACAGG - Intergenic
1018818221 6:167351552-167351574 CGCCCTCTGCAGCCCAGCGCCGG + Intronic
1018897431 6:168030055-168030077 CCCTGGCAGCTGCCCAGCACTGG - Intronic
1018909147 6:168091951-168091973 CACGTTCAGGTGTCCAGCACAGG + Intergenic
1018915665 6:168131002-168131024 CACCTTCACTTCCCCAGCACAGG - Intergenic
1019004502 6:168784780-168784802 CACCCAGAGCTGCTCAGCGCAGG - Intergenic
1019073612 6:169369432-169369454 CACCCTCTGCTGCACCGCAGGGG - Intergenic
1019130135 6:169867343-169867365 CACTTTCAAGTGCCCAGCACAGG - Intergenic
1019593079 7:1845352-1845374 CTCCCTCCGCTGCCCTGCATGGG + Intronic
1019917896 7:4145099-4145121 CTCCCTCAACTGGGCAGCACAGG + Intronic
1020139567 7:5605201-5605223 CACCCTCCGCTGCCCAGGGTAGG + Intronic
1021793429 7:24228809-24228831 CATCCTCTGATGCACAGCACAGG - Intergenic
1024032892 7:45479760-45479782 CTCCCTCAGCTGATCAGCAAGGG - Intergenic
1024249669 7:47496550-47496572 AACCCTCATCTGCACACCACCGG + Intronic
1024569055 7:50709370-50709392 CTCCCTCGGCCGCCCACCACTGG - Intronic
1026773658 7:73217816-73217838 CACCCTGAGGTCCCCAGCCCTGG - Intergenic
1026973955 7:74485099-74485121 CACCCTAAGCCACCCAGCTCCGG - Intronic
1027014517 7:74771210-74771232 CACCCTGAGGTCCCCAGCCCTGG - Intergenic
1027073516 7:75174747-75174769 CACCCTGAGGTCCCCAGCCCTGG + Intergenic
1029610265 7:101622874-101622896 TACCCTGTGCTCCCCAGCACAGG + Intronic
1033283366 7:140021520-140021542 ACACCCCAGCTGCCCAGCACTGG + Intergenic
1034217521 7:149420026-149420048 CCCCCTCTGCTGCCCCACACTGG - Intergenic
1034507133 7:151501829-151501851 CAGCCGCTGCTGCCCAGAACTGG + Intronic
1034642462 7:152615174-152615196 GACACTCAGCTGCCAGGCACAGG - Intergenic
1035418613 7:158709201-158709223 CCCTCACAGCTGCCCTGCACTGG - Intergenic
1035422172 7:158738977-158738999 CACACTCAGCAGCACAGCAGCGG + Intronic
1036052466 8:5215993-5216015 CATACTCAGGTTCCCAGCACAGG + Intergenic
1037782972 8:21883596-21883618 CAACCTCAACTTCCCAGCTCAGG - Intergenic
1038189747 8:25309050-25309072 CCCCCTCAGCTTCCAACCACAGG + Intronic
1038353742 8:26806824-26806846 CACCCTCAGCTTCCCAGAGTGGG + Intronic
1038699553 8:29837007-29837029 TACCTCCAGCTGCCCAGCATGGG + Intergenic
1039310376 8:36312098-36312120 CACCCTGAGCTGCACTGCAATGG + Intergenic
1041826301 8:62099586-62099608 CAGCCTCTGCTGCCCAGCCTTGG + Intergenic
1042176024 8:66037458-66037480 CTCCCTCTGCTGCCCACCTCTGG - Intronic
1043082651 8:75785041-75785063 CAGCCACAGCTGCCCAGCCATGG - Intergenic
1043738288 8:83775002-83775024 CAGCCTCAGATGCCCAGCTGAGG + Intergenic
1044355725 8:91220616-91220638 CATCCTCAGCAAACCAGCACGGG - Intronic
1047318693 8:123758176-123758198 CCACCTCAGCTGCCCAGGGCTGG + Intergenic
1048369715 8:133766811-133766833 CCCCCTCAGATTCCCAGCATGGG - Intergenic
1048371865 8:133785356-133785378 CTTCCTCAGCTCCCCAACACTGG - Intergenic
1048825177 8:138417281-138417303 CAGCCTCAGCTGCCCAGCCCAGG + Intronic
1049408269 8:142461203-142461225 CAGGCTCAGGTGCCCAGTACCGG + Intronic
1049413862 8:142486215-142486237 CTCACTCAGCTGCCAAGAACTGG + Intronic
1049724437 8:144138955-144138977 CTGGCTCAGCTGCCCAGCCCAGG + Intronic
1049763921 8:144344078-144344100 CACCCTCAGCTGCTCTACTCTGG + Intergenic
1049775497 8:144402008-144402030 CACCTACAGCAGCCCAGCCCCGG + Intronic
1050296860 9:4214089-4214111 CAGCCTCTGCTGCCCAGCATAGG + Intronic
1053152713 9:35753173-35753195 GACCCTCGGCTGCCCTGCAAAGG - Exonic
1053288826 9:36866761-36866783 CATCCTCATCTGCACAGCCCTGG + Intronic
1053575722 9:39356307-39356329 GGCCCTCAGGGGCCCAGCACAGG - Intronic
1054097292 9:60915012-60915034 GGCCCTCAGGGGCCCAGCACAGG - Intergenic
1054118698 9:61190641-61190663 GGCCCTCAGGGGCCCAGCACAGG - Intronic
1054452213 9:65409336-65409358 CACCCTCAGCAACCAAGCAGGGG + Intergenic
1054589059 9:66991923-66991945 GGCCCTCAGGGGCCCAGCACAGG + Intergenic
1055207618 9:73751563-73751585 CAGCCTCTGCTGCCCAGCCTTGG - Intergenic
1055394082 9:75854922-75854944 CACCCAGAGTTGGCCAGCACTGG + Intergenic
1056830307 9:89911823-89911845 CACCCTCAGCTCCCCTGCCATGG - Intergenic
1057630651 9:96716476-96716498 CTCCCTCTGATGCCCAGCAGTGG - Intergenic
1058572176 9:106358737-106358759 CAGCCTCAGATGCCCAACAAGGG - Intergenic
1058981373 9:110173688-110173710 CACCCCCAGATGCTCAGAACAGG - Intergenic
1059379890 9:113914879-113914901 CCCCCTCATCTTCCCAGCACTGG + Intronic
1059406280 9:114099712-114099734 CACCCCCAGCAGCTCAGCTCAGG + Intergenic
1059434935 9:114270507-114270529 CACCCTCAGCTCTCCAGAAAAGG - Intronic
1060484349 9:124037664-124037686 CAGTCTCGGGTGCCCAGCACTGG - Intergenic
1060556802 9:124512200-124512222 CCCCCTCCGCTGCCCTGCACGGG - Intergenic
1060817040 9:126640464-126640486 CACCCTCAAAGGCCCAGGACTGG - Intronic
1060879494 9:127108063-127108085 CACCCCCCGCTGCCCCGCCCCGG - Exonic
1060972228 9:127744841-127744863 CACTCTCGGCTGCCACGCACGGG + Exonic
1060986015 9:127819452-127819474 CACCCTCAGCAGTCCTGCTCCGG + Intronic
1060993963 9:127865344-127865366 TGCACTCAGCTGCCCAGAACTGG + Intergenic
1061203889 9:129152170-129152192 CACCCTCCGCTTCCCAGCCCAGG - Intergenic
1061968609 9:134030999-134031021 CACCCTCAGCCCGCCAGCAAGGG + Exonic
1062385496 9:136309402-136309424 CAGCCACAGCAGCCGAGCACAGG + Intergenic
1062418161 9:136464087-136464109 CCCCCTCACCTGGGCAGCACCGG + Intronic
1203767923 EBV:36089-36111 CACCCGCAGTAACCCAGCACTGG + Intergenic
1186281622 X:7999242-7999264 CAAACTCAGCTGCCCATGACAGG + Intergenic
1186349287 X:8727228-8727250 CACCCTCACCTCTCCAGGACAGG + Intronic
1190848380 X:54215225-54215247 CTCCCTCTGATGCCCAGCCCAGG + Intronic
1191252775 X:58267350-58267372 GACCCCCAGTGGCCCAGCACAGG + Intergenic
1200155160 X:153971253-153971275 CACCCCCAAGTCCCCAGCACTGG + Exonic
1200299073 X:154954184-154954206 CACCCTCAACTCCCAAGCCCTGG - Intronic
1201077198 Y:10196997-10197019 CACTCACAGCTGCCACGCACGGG + Intergenic