ID: 926920084

View in Genome Browser
Species Human (GRCh38)
Location 2:17931630-17931652
Sequence TCGGAGTTCCAGAATGAGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926920081_926920084 -3 Left 926920081 2:17931610-17931632 CCATGTGCGTTCACAGCATGTCG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 926920084 2:17931630-17931652 TCGGAGTTCCAGAATGAGGATGG 0: 1
1: 0
2: 2
3: 15
4: 162
926920077_926920084 27 Left 926920077 2:17931580-17931602 CCTTGAGCGTGGTGCTGGCCTCC 0: 1
1: 0
2: 5
3: 23
4: 261
Right 926920084 2:17931630-17931652 TCGGAGTTCCAGAATGAGGATGG 0: 1
1: 0
2: 2
3: 15
4: 162
926920080_926920084 6 Left 926920080 2:17931601-17931623 CCATCGTGGCCATGTGCGTTCAC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 926920084 2:17931630-17931652 TCGGAGTTCCAGAATGAGGATGG 0: 1
1: 0
2: 2
3: 15
4: 162
926920079_926920084 9 Left 926920079 2:17931598-17931620 CCTCCATCGTGGCCATGTGCGTT 0: 1
1: 0
2: 0
3: 2
4: 52
Right 926920084 2:17931630-17931652 TCGGAGTTCCAGAATGAGGATGG 0: 1
1: 0
2: 2
3: 15
4: 162
926920076_926920084 30 Left 926920076 2:17931577-17931599 CCTCCTTGAGCGTGGTGCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 119
Right 926920084 2:17931630-17931652 TCGGAGTTCCAGAATGAGGATGG 0: 1
1: 0
2: 2
3: 15
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926920084 Original CRISPR TCGGAGTTCCAGAATGAGGA TGG Exonic
900908328 1:5576388-5576410 TCGGAGCTCCAGGAAGAGGTGGG - Intergenic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
905032123 1:34892389-34892411 TGGGAGTTCCAGAAGGAGGAGGG + Intronic
905657351 1:39693171-39693193 TGGGAGGCCCAGAATGAGAAGGG - Intronic
906050705 1:42869001-42869023 TCTTAGTTCCAGAGGGAGGAAGG + Intergenic
906537197 1:46558020-46558042 TTTGATTTCCTGAATGAGGAAGG + Exonic
907823190 1:57990635-57990657 CCAGAGGTCCAGACTGAGGACGG + Intronic
908014394 1:59815537-59815559 TCGGCGATCCAGAAAGTGGAGGG - Intronic
910029110 1:82694757-82694779 TATGTGTTGCAGAATGAGGAGGG - Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
915855125 1:159375273-159375295 TGGGAGTTCCAGAAGGAAAATGG + Intergenic
916964005 1:169916584-169916606 ACGGAGACCCAGGATGAGGAGGG - Intergenic
917539256 1:175897634-175897656 TCTGAGTTCCAGTTTGAAGAGGG - Intergenic
918427235 1:184423232-184423254 GTGAAGTTCCTGAATGAGGAAGG - Intronic
919222886 1:194654220-194654242 TAGGAGTTCCAGAATCTAGAAGG + Intergenic
922748363 1:228059690-228059712 GCGGAGCTCCAGGATGGGGAGGG + Exonic
924676564 1:246184472-246184494 TCTGAGGTACAGATTGAGGATGG - Intronic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1065592667 10:27281135-27281157 TCCGAGTGTCAGAATGAGGCTGG + Intergenic
1065657699 10:27969149-27969171 TCCGAGTGTCAGAATGAGGCTGG - Intronic
1066073469 10:31846822-31846844 TTGGAGTTCCAGAAGGAGAAAGG - Intronic
1066454479 10:35561125-35561147 TGGGTGTCCCAGAATGAGGGAGG + Intronic
1066586618 10:36943517-36943539 TCTGATTTCCTGAATGAGGAAGG + Intergenic
1070827483 10:79399633-79399655 TCTGACTTCCAGAGTGAGGCTGG + Intronic
1071134412 10:82437152-82437174 TTGGAGTACCAGAAGGAGAAGGG - Intronic
1071692487 10:87836780-87836802 TCGGAGATCCAGAAGAAGAAAGG - Intronic
1071724155 10:88179177-88179199 TGGGAGTACCAGATTGAGGGTGG + Intergenic
1071895375 10:90060785-90060807 TGGGAGTTCCAGAGTAAGGGAGG - Intergenic
1072486722 10:95863176-95863198 ACAGATTTCCAGAAGGAGGAGGG + Intronic
1075600190 10:123761910-123761932 GAGGACTTCCAGAAGGAGGAGGG - Exonic
1081166814 11:39817799-39817821 TCTGAGCTCCAGAATTAGGAAGG - Intergenic
1081738488 11:45421813-45421835 TCTGAGTTCCCCCATGAGGATGG + Intergenic
1083979920 11:66158780-66158802 TTGGAGTTCTAGAAAGATGAAGG + Intronic
1084712967 11:70855487-70855509 TTGGGGTTCAAGAATCAGGAAGG - Intronic
1085205013 11:74726475-74726497 CCTGAGTACAAGAATGAGGATGG + Intronic
1085499922 11:77010699-77010721 TCAGAGTTCTAGAACAAGGAAGG + Intronic
1088712672 11:112522818-112522840 TCTGAGTTCCAGAAGCAGAATGG + Intergenic
1089824345 11:121260808-121260830 TAGGATTTCCAGAATGAGTTTGG + Intergenic
1093012064 12:14117855-14117877 TTGGAGTCCCAGAAGGAGAAGGG + Intergenic
1101112844 12:101503157-101503179 TAGAAGTTCCAAAATGAGAAGGG - Intergenic
1102633929 12:114305971-114305993 TCTGAGTTCCAGCATGAGGGAGG + Intergenic
1103086962 12:118068937-118068959 TGGGTCTTCCAAAATGAGGAAGG - Intronic
1103419898 12:120771946-120771968 TGGCTCTTCCAGAATGAGGATGG - Intronic
1103498870 12:121384948-121384970 TAAGGGTTTCAGAATGAGGATGG + Intronic
1104041209 12:125132423-125132445 CCGAAGTGCCAGAATGAGGCAGG + Intronic
1104485030 12:129143924-129143946 TGGGAGTTCAAGAGTGAGCAGGG - Intronic
1104980465 12:132571111-132571133 TCAGAATTCCCGAATGAGGCTGG - Intronic
1114810788 14:25896587-25896609 ACATAGTTCCAGAATGAGTAGGG - Intergenic
1117821371 14:59652959-59652981 TAGGAGTTCCAGAAAGAGAGAGG + Intronic
1119936679 14:78598407-78598429 TCTGACTTCCAGAAATAGGAAGG - Intronic
1122249683 14:100429197-100429219 TCAGAGTTCTAGAAGGTGGATGG - Intronic
1125718588 15:41834362-41834384 TGGGAGCTCCAGAATGAGTAAGG - Intronic
1126122682 15:45267756-45267778 TCCAAGTTCAAGAGTGAGGAGGG + Exonic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133920618 16:10149740-10149762 TAGGAGTTCTGGAGTGAGGAGGG - Intronic
1134530105 16:14975868-14975890 TCTGAGTTCCAGAAAGGGGTGGG + Intronic
1137021619 16:35433314-35433336 ACTGAGGTCCAGAAAGAGGAAGG - Intergenic
1138923956 16:61567822-61567844 TCTGAGTTCCAGGATTAAGACGG - Intergenic
1139531341 16:67544139-67544161 GAGGATTTCCAGAAGGAGGAAGG - Intronic
1139866242 16:70065086-70065108 TCTGAGTTCCAGAAAGGGGTGGG - Intergenic
1140518083 16:75558941-75558963 TCTGAATTCCAAAAAGAGGAGGG + Intergenic
1142377707 16:89714995-89715017 TTGGAGTTCCAGAAAGAAAATGG - Intronic
1147132397 17:38417229-38417251 GCAGAGTTCCTGAATAAGGAAGG - Intergenic
1147542548 17:41372801-41372823 TTGAAGTCCCACAATGAGGAAGG - Intronic
1149160007 17:53681177-53681199 TGGGAGTCCCAGAAAGAGAAAGG - Intergenic
1151518853 17:74614356-74614378 GTGGAGTTCCAGGAGGAGGAGGG + Intronic
1152095386 17:78269130-78269152 TGGTAATTCCAGATTGAGGAGGG + Intergenic
1155958109 18:31970964-31970986 TCTGACTTTCAGAAGGAGGATGG - Intergenic
1157500622 18:48188088-48188110 TCTGACTTCCAAAATGAAGATGG - Intronic
1158059581 18:53323221-53323243 GAGGAGTTCAAGAAAGAGGAAGG - Intronic
1163405498 19:17119516-17119538 TGGCAGTTCCAGAGTAAGGATGG - Intronic
1164918048 19:32067711-32067733 GCTGAGTTCCAGAATCAAGATGG - Intergenic
1166381959 19:42359294-42359316 TGGGAGTCCCAGGATGGGGATGG - Intronic
1167203138 19:48081421-48081443 TCAGAGATTCAGAAAGAGGAGGG + Intronic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
926903536 2:17784558-17784580 TCCCAGTTCCAGAATGAGGAAGG + Exonic
926920084 2:17931630-17931652 TCGGAGTTCCAGAATGAGGATGG + Exonic
927137551 2:20107922-20107944 ACTGAGCTACAGAATGAGGAGGG - Intergenic
930349695 2:50234805-50234827 TCGGAGATTCAGAAAGAAGAAGG + Intronic
932226347 2:70044079-70044101 TCTGAGAACCAGACTGAGGAAGG - Intergenic
932591245 2:73069205-73069227 TCTGACTTGCAGAAAGAGGAAGG + Intronic
933595566 2:84279751-84279773 TCTGAGTACCATAATGAAGAAGG + Intergenic
933614665 2:84471423-84471445 TAGGAGTTGCAGAAGGATGAAGG + Intergenic
934699279 2:96426563-96426585 TAGTTGTTCCAGAATGAGAAAGG + Intergenic
935706301 2:105860476-105860498 TAGGCGTCTCAGAATGAGGAGGG + Intronic
937629798 2:124088041-124088063 TCAGAGTTCCAGAAGAAAGAGGG - Intronic
938395484 2:130944368-130944390 TCAGAGTTCCAGAAGGAGAAGGG - Intronic
944863225 2:203835199-203835221 ACTGAGGTCCAGGATGAGGATGG - Intergenic
946393791 2:219433009-219433031 TCAGTATCCCAGAATGAGGATGG + Intergenic
947059128 2:226142487-226142509 TCTGTGTACCAGAATGATGATGG - Intergenic
947814671 2:233028416-233028438 TCTGAATTCCAAAAGGAGGAAGG - Intergenic
947819056 2:233058348-233058370 TGGGATTTCCTGAATGTGGAGGG + Intergenic
947952704 2:234161770-234161792 TTGGAGTTCCAAAATGTGGTCGG + Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
1169278881 20:4250560-4250582 TCATAGTTGCAGAATGAGGAGGG + Intergenic
1170360720 20:15543147-15543169 TTGGAGTTTTAGAATGATGATGG + Intronic
1170464048 20:16606807-16606829 TCAGAGATCCAGACTGAGGGAGG + Intergenic
1170730139 20:18966963-18966985 TCGGAGTACCTGAAAGAGAAAGG + Intergenic
1170912159 20:20583541-20583563 TGGGACTTACAAAATGAGGATGG + Intronic
1172763756 20:37339854-37339876 CCTGAGTTCCAGATTCAGGAAGG + Intergenic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173256787 20:41399506-41399528 TAGGAGTGCCAGATTTAGGAGGG - Intergenic
1177772987 21:25537845-25537867 TGGGAGTTCCAGAAGGAGAGAGG - Intergenic
1178370395 21:32022211-32022233 TCAGGGTTCCAGGATGAGGGAGG - Intronic
1181839737 22:25646424-25646446 TTGGAGTTTCAGAAAGAGAAGGG + Intronic
950260679 3:11541670-11541692 TCAGAGTTCCAGGGTGAGGTGGG - Intronic
951059035 3:18183117-18183139 TTGGAGTCCCAGATTGAGGGTGG - Intronic
952351325 3:32541669-32541691 CCAGAGTTACAGAATGAGCATGG - Intronic
960232243 3:115242526-115242548 TGGGAGCTCCAGATTGAGGTTGG - Intergenic
962627603 3:137241968-137241990 GCTGAGTTCCAGGATGAGGGGGG - Intergenic
963320771 3:143807012-143807034 TCGGAGAGCCAGTATGAGGAAGG - Intronic
966746663 3:183283468-183283490 AGGGCATTCCAGAATGAGGAAGG - Intronic
967823845 3:193862952-193862974 TTGGAGTCCCAGACTGAGGCAGG - Intergenic
967958017 3:194893136-194893158 TAGGAGTTCCAGAAAGAAAATGG + Intergenic
973061599 4:45733145-45733167 TCTGATTTCTAGAATGAGGAAGG - Intergenic
978136406 4:105266785-105266807 TTGGAGTACCAGAAGGAGGTGGG + Intronic
982419592 4:155178861-155178883 TGGGAGTTCCAAAAGGAGGAAGG - Intergenic
984962159 4:185108381-185108403 CCGGAATTCCAAAAGGAGGAGGG + Intergenic
987109529 5:14672348-14672370 TGGGAGGGCCAGACTGAGGAAGG - Intronic
987876810 5:23690479-23690501 TCGGGGTTGCAGAAGGATGAGGG - Intergenic
988092642 5:26562857-26562879 TCTTAGTTCCAGAGGGAGGAAGG + Intergenic
988267538 5:28971783-28971805 TCTTAGTTCCAGAGGGAGGAAGG - Intergenic
988407018 5:30836876-30836898 TCTTTGTTCCAGAATCAGGAAGG + Intergenic
989781419 5:45269597-45269619 TCTAAATACCAGAATGAGGAGGG + Intronic
990550535 5:56872939-56872961 GCTGAGTTCCATAATGAGTAAGG - Exonic
992162412 5:74016139-74016161 GTGGAGTTTCAGACTGAGGAGGG - Intergenic
994956878 5:106544353-106544375 TGGGAGATCCAGAGGGAGGACGG - Intergenic
997136134 5:131328491-131328513 ACAGAGTTCCAGAAAGAGGGAGG - Intronic
999710525 5:154314428-154314450 ACTGAGGTCTAGAATGAGGAGGG - Intronic
1001839137 5:174858675-174858697 TGGGAGTCCCAGAAAGAGAAAGG - Intergenic
1002328909 5:178428435-178428457 TCCGAGCAGCAGAATGAGGAAGG - Intronic
1002505950 5:179679226-179679248 CCGGATGTCCAGAATGATGAAGG + Exonic
1003684647 6:8289809-8289831 TCGGATATCCAGGCTGAGGAAGG - Intergenic
1003758827 6:9151652-9151674 TCTTAGTTCCAGAGGGAGGAAGG + Intergenic
1004211052 6:13644562-13644584 TCGGAGATCGAGAAGGAGAATGG - Exonic
1006606479 6:35260700-35260722 ACTGAGGTCCAGACTGAGGAGGG - Intronic
1008657654 6:53632212-53632234 TCAGTGTTCCAGAAAAAGGATGG + Intergenic
1008927275 6:56900131-56900153 CTGGAGTTCTAGAATGAGGATGG - Intronic
1010731063 6:79391761-79391783 TCTGTGTTCTAGAATGGGGAGGG + Intergenic
1013612900 6:111811764-111811786 TTGGAGTTCGAAAATGAAGAAGG + Intronic
1015041935 6:128731641-128731663 TCAGAGTTCCAGAAGAAGGCAGG + Intergenic
1018445197 6:163851804-163851826 TGGGAGTTCCAGAAGGAGACAGG - Intergenic
1019491558 7:1316195-1316217 TAGGAATTGAAGAATGAGGATGG + Intergenic
1021519033 7:21520037-21520059 TCAGACTTCCAGTATGTGGATGG + Intergenic
1021667106 7:22994930-22994952 TCGTCCTTCCAGAATTAGGATGG - Intronic
1022386728 7:29906570-29906592 TGGGAGTTCTAGAAGGAGAAAGG + Intronic
1023156523 7:37257226-37257248 TTGGAGTTCCATCATGAGGGAGG - Intronic
1026396472 7:69959528-69959550 TCCGAGATCCAAAATGAGAATGG - Intronic
1028442664 7:90881461-90881483 TCGGAGTGCCAGAAGGAGATGGG + Intronic
1028922886 7:96326405-96326427 GAGGAATTCTAGAATGAGGAGGG - Intergenic
1036627197 8:10482078-10482100 TTGGGGTTCCAGGAAGAGGATGG + Intergenic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1037747582 8:21659240-21659262 TGGGAGTGCCAGGATGGGGAGGG - Intergenic
1038136359 8:24790558-24790580 TCGGAGCTGGAGAATGGGGAGGG - Intergenic
1039293688 8:36126559-36126581 TTGGAGTACCAGAAGGAGGTGGG - Intergenic
1040814089 8:51488597-51488619 CCTAAATTCCAGAATGAGGAAGG - Intronic
1041733615 8:61087468-61087490 TCTGAGTTGGAGCATGAGGAGGG - Intronic
1045920036 8:107518660-107518682 TCGGAGTGCCTAAATGTGGAAGG - Intergenic
1047432729 8:124806799-124806821 TCGGAGTTCCAGCATCAGTGTGG + Intergenic
1048055955 8:130865643-130865665 TCAGAGTTCTAGAAAGAGCATGG + Intronic
1048578449 8:135711080-135711102 TCTGAGTTCCAGCTGGAGGAAGG - Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1053160426 9:35810136-35810158 GAGGAGTGCCAGGATGAGGATGG + Intronic
1053529174 9:38861427-38861449 TGAGAGTTCCAGAAGGAGAAGGG + Intergenic
1054201399 9:62085856-62085878 TGAGAGTTCCAGAAGGAGAAGGG + Intergenic
1054636960 9:67502504-67502526 TGAGAGTTCCAGAAGGAGAAGGG - Intergenic
1056654157 9:88495585-88495607 CCGGATTTCCAGCATCAGGAGGG - Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1058932022 9:109730088-109730110 TGGGTGTTCAAGAATGAGTAGGG + Intronic
1059370376 9:113826225-113826247 TCAGAGTCCCAGAAAGAGAAGGG + Intergenic
1059636923 9:116180130-116180152 TTGGAGTCACAGAATGTGGATGG + Intronic
1190517343 X:51237289-51237311 TTAGAGTTCCAGAAGGAGAAGGG + Intergenic
1191629811 X:63311026-63311048 TCTTAGTTCCAGAGGGAGGAAGG - Intergenic
1191694349 X:63974158-63974180 TGGGGGTTGCAGAATGAGGATGG + Intergenic
1192564541 X:72152775-72152797 TAGGATTTCCAGAATTAGGAAGG + Intergenic
1196121435 X:112055008-112055030 TGGAAATTCCAGAATAAGGAGGG + Intronic
1197985560 X:132263240-132263262 TTGGAGTTCCAGAATAAAAAGGG + Intergenic
1198618979 X:138485955-138485977 ACGGGATTCCAGAATGAGGGAGG - Intergenic
1199780313 X:151052224-151052246 TTGGAGTGCCAGAATGAAAAGGG + Intergenic
1199902961 X:152195615-152195637 TCGGATTTGAAGAAAGAGGAAGG - Intronic