ID: 926923976

View in Genome Browser
Species Human (GRCh38)
Location 2:17968228-17968250
Sequence ACACTAAAAATCTGTGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 212}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926923969_926923976 16 Left 926923969 2:17968189-17968211 CCACCCGCCTACCAGTCTGCTTC 0: 1
1: 0
2: 0
3: 15
4: 168
Right 926923976 2:17968228-17968250 ACACTAAAAATCTGTGGCAGAGG 0: 1
1: 0
2: 1
3: 15
4: 212
926923974_926923976 -6 Left 926923974 2:17968211-17968233 CCTAAAAGTTTTTCTTCACACTA 0: 1
1: 0
2: 1
3: 24
4: 346
Right 926923976 2:17968228-17968250 ACACTAAAAATCTGTGGCAGAGG 0: 1
1: 0
2: 1
3: 15
4: 212
926923973_926923976 5 Left 926923973 2:17968200-17968222 CCAGTCTGCTTCCTAAAAGTTTT 0: 1
1: 0
2: 1
3: 23
4: 279
Right 926923976 2:17968228-17968250 ACACTAAAAATCTGTGGCAGAGG 0: 1
1: 0
2: 1
3: 15
4: 212
926923971_926923976 12 Left 926923971 2:17968193-17968215 CCGCCTACCAGTCTGCTTCCTAA 0: 1
1: 0
2: 0
3: 11
4: 240
Right 926923976 2:17968228-17968250 ACACTAAAAATCTGTGGCAGAGG 0: 1
1: 0
2: 1
3: 15
4: 212
926923972_926923976 9 Left 926923972 2:17968196-17968218 CCTACCAGTCTGCTTCCTAAAAG 0: 1
1: 0
2: 1
3: 15
4: 179
Right 926923976 2:17968228-17968250 ACACTAAAAATCTGTGGCAGAGG 0: 1
1: 0
2: 1
3: 15
4: 212
926923970_926923976 13 Left 926923970 2:17968192-17968214 CCCGCCTACCAGTCTGCTTCCTA 0: 1
1: 0
2: 0
3: 22
4: 221
Right 926923976 2:17968228-17968250 ACACTAAAAATCTGTGGCAGAGG 0: 1
1: 0
2: 1
3: 15
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926923976 Original CRISPR ACACTAAAAATCTGTGGCAG AGG Intronic
900324516 1:2101782-2101804 ACAGCAAAGATGTGTGGCAGAGG + Intronic
901240379 1:7689583-7689605 AAAAGAAAAATCAGTGGCAGAGG + Intronic
902597202 1:17517598-17517620 ACTCTAAAAACCTTTGACAGTGG - Intergenic
907780558 1:57562386-57562408 ACAAAACAAAACTGTGGCAGGGG + Intronic
912770174 1:112456614-112456636 ACGGGAAAAATCTGTGGCATTGG + Exonic
915382603 1:155455807-155455829 ACAATATAAATCTGTAGGAGAGG + Intronic
915910321 1:159910837-159910859 GGACTGAGAATCTGTGGCAGAGG - Intergenic
916395171 1:164379111-164379133 ACACTGAAAAGCTGGGGGAGTGG + Intergenic
917679494 1:177351338-177351360 ACAGTAACATTCTGTGGTAGAGG + Intergenic
918095818 1:181333222-181333244 ACACTAGAAGTCTGTGGAAGAGG + Intergenic
918480842 1:184974906-184974928 ACACTTAGAATCTGTGGGAGTGG + Intergenic
919208304 1:194446712-194446734 ACAATGAAAATCGGTGGCATTGG - Intergenic
919585285 1:199430948-199430970 ATACTAAAAATCTGAGGCCAGGG + Intergenic
921318456 1:213914560-213914582 ACACTCAGAAGCAGTGGCAGAGG + Intergenic
921660910 1:217801557-217801579 ACACAGATAATCAGTGGCAGAGG + Intronic
923242527 1:232099521-232099543 ACAGTAGACATCTGTGTCAGGGG - Intergenic
924148118 1:241098093-241098115 ACATTTAAAATGTTTGGCAGAGG - Intronic
1065069225 10:22004567-22004589 AAACTAAAAATCTGTGGTAGGGG - Intergenic
1068368050 10:56077383-56077405 AAACTAAAAATCTGAGCCATGGG + Intergenic
1070541028 10:77415491-77415513 AGACAAGAAAACTGTGGCAGGGG + Intronic
1072248807 10:93566108-93566130 AGATTAAAAATCTGGGGTAGAGG + Intergenic
1077602515 11:3583260-3583282 ACAGTATAAATTTTTGGCAGTGG - Intergenic
1077805649 11:5589078-5589100 ATGATAAAAATGTGTGGCAGGGG - Intronic
1078604191 11:12760698-12760720 ACCCTAAAAATGTGTGGAATTGG - Intronic
1078893406 11:15577575-15577597 ACATTGAACATCTGGGGCAGAGG - Intergenic
1080210399 11:29779340-29779362 ACACTTAAGCTCTGTGCCAGGGG - Intergenic
1081313993 11:41608768-41608790 ACTGTAAAATTCTGTGGCACTGG - Intergenic
1082768948 11:57190894-57190916 AGGAGAAAAATCTGTGGCAGAGG + Exonic
1084258408 11:67957806-67957828 ACAGTATAAATTTTTGGCAGTGG - Intergenic
1084814337 11:71637402-71637424 ACAGTATAAATTTTTGGCAGTGG + Intergenic
1085502455 11:77036707-77036729 ACACTAGAAAGCAGTGGCAGTGG + Intronic
1086321905 11:85658384-85658406 AATTTAAAAATATGTGGCAGAGG - Intergenic
1087553435 11:99682399-99682421 ATGCTAAAAATATGAGGCAGGGG + Intronic
1089403737 11:118180613-118180635 AAACCAAAAATCTCTGGCAACGG - Intergenic
1090240506 11:125178194-125178216 ACACAGGAAATCAGTGGCAGAGG + Intronic
1090392925 11:126401214-126401236 CCCCTGAAAATGTGTGGCAGGGG + Intronic
1090634677 11:128683652-128683674 AGAACAAAAATCTGGGGCAGTGG + Intergenic
1091804472 12:3346098-3346120 ACACTGCAGATCAGTGGCAGGGG + Intergenic
1092428659 12:8392611-8392633 ACAGTATAAATGTTTGGCAGTGG - Intergenic
1092429739 12:8398756-8398778 ACAGTATTAATTTGTGGCAGTGG - Intergenic
1094074102 12:26453768-26453790 ACACTTGAAATATGTGGGAGGGG - Intronic
1095295347 12:40521252-40521274 AAAATAAAATTCAGTGGCAGAGG + Intronic
1096417540 12:51426635-51426657 ACACAAAAGACCTGTGGCAGAGG + Intronic
1096771245 12:53937347-53937369 GCATTTAAAACCTGTGGCAGAGG + Intergenic
1097791629 12:63821668-63821690 AAAATAAAAGTCTATGGCAGGGG - Intergenic
1098089451 12:66885427-66885449 ACAAAAAAAATCTGTAGCAAAGG + Intergenic
1099803164 12:87482418-87482440 TCATGAAAAATCTGTTGCAGAGG - Intergenic
1100109781 12:91226157-91226179 ACACTGATAATCTGTGAAAGAGG + Intergenic
1100130315 12:91484738-91484760 AAAATAAAAATCTGTGGCACTGG + Intergenic
1101219006 12:102617118-102617140 ATACAAAATATCTATGGCAGAGG + Intergenic
1105797945 13:23875369-23875391 AAACTAAAAATCTCATGCAGAGG - Intronic
1106475607 13:30095571-30095593 ACACTTGAATTCTGGGGCAGGGG + Intergenic
1107330541 13:39295324-39295346 AAACTAAAGATCAATGGCAGTGG - Intergenic
1107617486 13:42185362-42185384 ACACTATGATCCTGTGGCAGTGG - Intronic
1107873706 13:44770412-44770434 ACCCTAAAAATCATTAGCAGTGG + Intergenic
1110864035 13:80374907-80374929 ATACTAATAATTTGTGGCAAAGG + Intergenic
1113050174 13:106202401-106202423 ACACCAAAAATATCTGTCAGTGG + Intergenic
1114751792 14:25212445-25212467 AGAGTGAAAATCTGTGGGAGTGG + Intergenic
1115725758 14:36214678-36214700 ACACTAAAAAAATGTGGCAATGG - Intergenic
1116426232 14:44795432-44795454 AGACAAAAAATCAGTGGGAGAGG + Intergenic
1117085915 14:52200830-52200852 CCACTAAACCTCTGTGGCACAGG + Intergenic
1117646559 14:57859382-57859404 ACACTAATCATCTCTGGTAGTGG + Intronic
1118142796 14:63103044-63103066 ACACTAAAAGTCTATGGCATTGG + Intergenic
1119038102 14:71247600-71247622 ACAGTGAATATCTGGGGCAGTGG - Intergenic
1127526910 15:59802375-59802397 ACAGTACAGATCTGGGGCAGTGG - Intergenic
1128819766 15:70641270-70641292 ACACTAAAATTCAGTGCCACTGG - Intergenic
1128900239 15:71414094-71414116 ACACAGTAAATCTGTGGAAGAGG - Intronic
1131666221 15:94573498-94573520 AAAATAAAATTCTGTAGCAGGGG - Intergenic
1133275383 16:4635108-4635130 ACATTAAAAATCAGAGGCTGGGG + Intronic
1133369560 16:5237754-5237776 ACAGTATAAATTTTTGGCAGTGG + Intergenic
1134223845 16:12376433-12376455 GTATTGAAAATCTGTGGCAGGGG + Intronic
1135714375 16:24749033-24749055 ACACTAAGAATATCAGGCAGGGG - Intronic
1137944287 16:52718732-52718754 ACGCTGAAACTCTGTGGCTGTGG + Intergenic
1140137096 16:72216385-72216407 AAACCAAAAATATGTGGCATTGG + Intergenic
1141963555 16:87425660-87425682 ACACCAAAAATCTTGGGGAGAGG + Intronic
1148705314 17:49625233-49625255 ACACTGAAAATCTTTAGTAGGGG + Intronic
1149011201 17:51858404-51858426 ACACTGAAAATTGGTGGAAGGGG - Intronic
1152030398 17:77838655-77838677 ACCCAAAGAATCTGTGGCAATGG + Intergenic
1153216066 18:2822027-2822049 TCACCAAAGATGTGTGGCAGTGG - Intergenic
1155091883 18:22520113-22520135 ACAGTAGAACTCGGTGGCAGAGG + Intergenic
1157217807 18:45800202-45800224 ACATTAAAACTCTGTGGAGGTGG - Intergenic
1157829078 18:50840131-50840153 ACACTTGAACACTGTGGCAGAGG - Intergenic
1157853680 18:51083652-51083674 ACACATCAAATTTGTGGCAGAGG - Exonic
1158456864 18:57615853-57615875 ACATTAAAAAGATGTGGCATAGG - Exonic
1159079405 18:63720360-63720382 ATACTAAGATTCTCTGGCAGAGG + Intronic
1160001633 18:75029957-75029979 ACATTAAAAATATGGGGAAGAGG + Intronic
1160253228 18:77222446-77222468 ACCCTAATAAACTGTGGCACTGG - Intergenic
1161564735 19:4995276-4995298 AGACTCCAAATCTGTGTCAGTGG + Intronic
1163680836 19:18681441-18681463 ACACTAAAAAGTTGAGGGAGTGG + Intergenic
1164549771 19:29199736-29199758 ACACTTAAAACCTATAGCAGAGG - Intergenic
1165531061 19:36402108-36402130 ACACTCAAAATGTATTGCAGAGG - Intronic
1166733793 19:45072734-45072756 ACACGAAAAATCTGTGGAGTGGG + Intronic
1168473910 19:56662494-56662516 ACTCTAAAAATCTTTTGTAGAGG + Exonic
1168673474 19:58258915-58258937 CCTCTAAAAATGAGTGGCAGAGG - Intronic
926923976 2:17968228-17968250 ACACTAAAAATCTGTGGCAGAGG + Intronic
929713159 2:44285131-44285153 ACACTAAAAATCTCTTGCCCTGG + Intronic
929875056 2:45789727-45789749 TCATTAAAAATGGGTGGCAGGGG - Intronic
930172393 2:48265061-48265083 ACGCAAAAAAACTGTGGCTGGGG - Intergenic
930368411 2:50472884-50472906 ACAATAAAAACCTATGCCAGAGG + Intronic
931629469 2:64285935-64285957 ACAATAAACATGTGGGGCAGGGG - Intergenic
934986711 2:98892930-98892952 ACCAAAAAAATCTGTGGCTGAGG - Intronic
935108205 2:100066113-100066135 ACCCCAAAAATATCTGGCAGGGG - Intronic
935424010 2:102900473-102900495 AAACAAAAGATCTGTGGCAATGG - Intergenic
935500481 2:103831946-103831968 ACATTAAAAATTTTTAGCAGGGG - Intergenic
937163190 2:119785540-119785562 ACACTAATAATCTATGGAAATGG - Intronic
937301110 2:120842732-120842754 ACATTATATATCTGTGGCTGAGG - Intronic
937734399 2:125272165-125272187 CCACTAATAATCTTTGGCACTGG - Intergenic
939584274 2:143987896-143987918 ACACAAAAAATCTGTGGGCTGGG + Intronic
939660202 2:144879873-144879895 ACAATTAATAACTGTGGCAGGGG + Intergenic
940816176 2:158300316-158300338 ACACTGAAAATCTAGGGCAGGGG + Intronic
941341042 2:164303653-164303675 ACACTAGAAATATATAGCAGGGG + Intergenic
941720614 2:168808446-168808468 ACACTATAAAGCTGGGGCTGAGG - Intronic
942009515 2:171746117-171746139 ACCCTCAAAATCTGTTGCATGGG - Intronic
942137060 2:172936569-172936591 ACAATAAAAATGTATTGCAGAGG - Intronic
943040672 2:182801125-182801147 ACATTAAAAATTGGTGGGAGAGG - Intergenic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
946680114 2:222204971-222204993 AAACAAAAAATGTATGGCAGGGG - Intronic
948414704 2:237794572-237794594 ACACTGAAAATACCTGGCAGAGG - Intronic
1170786540 20:19472440-19472462 TTATCAAAAATCTGTGGCAGAGG - Intronic
1170843641 20:19944179-19944201 CAACTAAAAATCTTTGGCACAGG - Intronic
1177010075 21:15721260-15721282 ACAGTAGAAATCTATAGCAGTGG + Intergenic
1178101799 21:29277837-29277859 AGCCTAAAAATCGATGGCAGTGG - Intronic
1178473177 21:32913326-32913348 ACACTAAAAATAAGGGGAAGGGG - Intergenic
1181747483 22:24965931-24965953 ACACACAAAATCTATGTCAGAGG - Intronic
950423954 3:12914697-12914719 ACACCACAAAGCTATGGCAGAGG + Intronic
952301526 3:32107921-32107943 ATACTAAGACTCTGTTGCAGTGG + Intronic
952560361 3:34585513-34585535 ATGCTTGAAATCTGTGGCAGTGG - Intergenic
956204526 3:66741629-66741651 ATGGTAAAAATCTGTGACAGGGG + Intergenic
957073366 3:75582320-75582342 ACAGTATAAATTTTTGGCAGTGG - Intergenic
957736579 3:84211346-84211368 ACAGTAAAGATCTGTGGCCCAGG + Intergenic
957984277 3:87552206-87552228 AAACAAAAAATATTTGGCAGAGG - Intergenic
960343087 3:116498877-116498899 AAAAAAAAAATCTTTGGCAGGGG + Intronic
961388928 3:126540948-126540970 ACACAAAAAATCATAGGCAGGGG + Intronic
961566739 3:127769488-127769510 ACACTAAAACCCTGTGACGGAGG + Intronic
961873679 3:130005130-130005152 ACAGTATAAATTTTTGGCAGTGG - Intergenic
965285226 3:166811057-166811079 ACAAGAAAAAACTGTGGTAGAGG + Intergenic
965920587 3:173908308-173908330 TCACTAAGAATTTGAGGCAGAGG - Intronic
966207858 3:177423307-177423329 ACTGTAAACATCTGGGGCAGGGG - Intergenic
966828357 3:183984657-183984679 AACCTAAAAATCTGAGGGAGGGG - Intronic
967230941 3:187336875-187336897 AAAATAAAACTCTCTGGCAGCGG + Intergenic
969016954 4:4109619-4109641 ACAGTATAAATTTTTGGCAGTGG - Intergenic
969736998 4:8998697-8998719 ACAGTATAAATTTTTGGCAGTGG + Intergenic
969796184 4:9530283-9530305 ACAGTATAAATTTTTGGCAGTGG + Intergenic
972980133 4:44688191-44688213 AAACTAAAAGTCTGTCTCAGTGG + Intronic
974153970 4:58046518-58046540 ACAATAACAATCAGTGCCAGAGG - Intergenic
974183038 4:58407874-58407896 ACACTAAAAATCAATGAAAGTGG - Intergenic
974389399 4:61245972-61245994 ATGCTAACAAACTGTGGCAGGGG - Intronic
977031809 4:91893013-91893035 ACGCTAAAGAAGTGTGGCAGTGG + Intergenic
977569548 4:98615198-98615220 GCACAAAAACTCTGTAGCAGGGG - Intronic
977825562 4:101527343-101527365 ACAATAAAAGTGTGTGGCAAAGG + Intronic
978341405 4:107724339-107724361 CCACTAAAGAAGTGTGGCAGTGG - Intergenic
981862557 4:149374950-149374972 ACACAAAGAAAGTGTGGCAGAGG - Intergenic
983073709 4:163299339-163299361 ACACTAAAAATCATTTTCAGTGG - Intergenic
985108705 4:186525015-186525037 AAACTAGAAATCAGTGGCAAAGG - Intronic
985157993 4:187013002-187013024 ACACTATACTTCTGTGACAGAGG + Intergenic
987578174 5:19757102-19757124 ACAACAAAAAAGTGTGGCAGTGG - Intronic
992983903 5:82207085-82207107 ACAGTCAAAACCTGGGGCAGGGG - Intronic
993554219 5:89315505-89315527 ACACTAAAAATTTCTCTCAGAGG - Intergenic
993628620 5:90256805-90256827 ACAGTAAAATTCTTTGGTAGAGG + Intergenic
994710188 5:103256903-103256925 ACACTAAAAAGCTCTGGGAAGGG + Intergenic
994869318 5:105325081-105325103 ACACTTAAAATATGTGGCTTTGG + Intergenic
995408837 5:111832108-111832130 ACATAAAAACTTTGTGGCAGTGG + Intronic
996263855 5:121510570-121510592 ACATTAAAAATAAGTGGCAGTGG + Intergenic
997806951 5:136927558-136927580 ACAGTAAAGATGTATGGCAGGGG + Intergenic
999529256 5:152444211-152444233 AGACTCAGAATCTCTGGCAGTGG + Intergenic
1000828704 5:166077356-166077378 GCACTAAAAGTCAGTGGCATAGG - Intergenic
1001934195 5:175693053-175693075 ACACAGCCAATCTGTGGCAGGGG - Intergenic
1005719242 6:28584706-28584728 AAAGTAAAAATCTGAGCCAGGGG + Intronic
1006609026 6:35281541-35281563 GCACTAAAAAACTGTGACAGGGG - Intronic
1007298080 6:40843850-40843872 TCACTAAAAATCATTGTCAGTGG + Intergenic
1009059685 6:58383898-58383920 TTACTAAAATTCTATGGCAGTGG + Intergenic
1009231226 6:61063496-61063518 TTACTAAAATTCTATGGCAGTGG - Intergenic
1009389945 6:63133864-63133886 AAGCTAAAGATGTGTGGCAGTGG - Intergenic
1009854505 6:69244604-69244626 ACACTGAATCTCTGGGGCAGGGG - Intronic
1013723871 6:113067743-113067765 ACACAGAAAGTTTGTGGCAGAGG + Intergenic
1014053016 6:116978164-116978186 ACCCAAAGAATGTGTGGCAGAGG + Intergenic
1015021323 6:128479305-128479327 ACACTAAAAATTAGGGGGAGGGG + Intronic
1017116374 6:150980891-150980913 ACACTAGAGATCTGTAGCGGAGG + Intronic
1017546039 6:155451337-155451359 ACACTACCAATCAGTAGCAGGGG + Intronic
1018737691 6:166700857-166700879 ACACAAAAAAAGGGTGGCAGAGG - Intronic
1019335208 7:479493-479515 GCTCTGAAAATCTGTGACAGAGG + Intergenic
1020728921 7:11855602-11855624 ACACTAAAAGACTGAGGCAAAGG + Intergenic
1021422610 7:20462432-20462454 ATATTAAAATTTTGTGGCAGGGG + Intergenic
1024103942 7:46061980-46062002 ATATTTAAAAACTGTGGCAGAGG + Intergenic
1025561362 7:62377535-62377557 GCAGTAAAAACCTGTGGCGGCGG - Intergenic
1031682195 7:124688556-124688578 ACACTAAAGAAGTGAGGCAGTGG + Intergenic
1032329147 7:130961568-130961590 ACACGAACAAGCTTTGGCAGTGG - Intergenic
1036259760 8:7230197-7230219 ACAGTATAAATTTTTGGCAGTGG - Intergenic
1036306852 8:7609325-7609347 ACAGTATAAATTTTTGGCAGTGG + Intergenic
1036307920 8:7615455-7615477 ACAGTATAAATTTTTGGCAGTGG + Intergenic
1036311803 8:7688767-7688789 ACAGTATAAATTTTTGGCAGTGG - Intergenic
1036357702 8:8057313-8057335 ACAGTATAAATTTTTGGCAGTGG + Intergenic
1036358775 8:8063456-8063478 ACAGTATAAATTTTTGGCAGTGG + Intergenic
1036830650 8:12017172-12017194 ACAGTATTAATTTGTGGCAGTGG - Intergenic
1036892183 8:12603496-12603518 ACAGTATAAATTTTTGGCAGTGG - Intergenic
1036893247 8:12609633-12609655 ACAGTATAAATTTTTGGCAGTGG - Intergenic
1036900801 8:12667620-12667642 ACAGTATAAATTTTTGGCAGTGG - Intergenic
1037389212 8:18375003-18375025 TCACTAAAAAAATCTGGCAGAGG + Intergenic
1038817421 8:30919252-30919274 ACAATAAGAATCTTTGGCACGGG - Intergenic
1040046137 8:42965619-42965641 ACACTAGAAATCTATGGCTAGGG - Intronic
1042249618 8:66742760-66742782 ATACAAAAAATGTGGGGCAGTGG - Intronic
1043211976 8:77531337-77531359 AAACTAAAAAACTGTGGAACAGG + Intergenic
1043517451 8:81007818-81007840 GCACTAAATAGCCGTGGCAGTGG + Intronic
1045721132 8:105112197-105112219 ACAGTAAAAATCTGAGTCATAGG - Intronic
1048882892 8:138884752-138884774 ACATAAAAAACATGTGGCAGGGG + Intronic
1049381134 8:142316440-142316462 ACACTAAAAAACTGTAACAGAGG - Intronic
1051487292 9:17622863-17622885 ACTCTCAAAAACTGCGGCAGAGG - Intronic
1055235394 9:74116231-74116253 GCATTAAGAATCTTTGGCAGAGG + Intergenic
1055486217 9:76759221-76759243 ACACAAAAACTCTGTGACAGAGG - Intronic
1056836863 9:89962531-89962553 ACACTAAAAATTGGTGTCATTGG - Intergenic
1058003615 9:99892702-99892724 ACAATAAAAATCTGGGGGAGGGG - Intergenic
1061650510 9:132044578-132044600 ACACTGAAAATCTGGTGCAGTGG - Intronic
1186050511 X:5589200-5589222 AAACTAAAAACATGTGACAGTGG - Intergenic
1186649913 X:11548060-11548082 AAACTAAAAATCTCTGGGGGTGG - Intronic
1186846259 X:13533990-13534012 TAACTAAAAATGTGAGGCAGAGG + Intergenic
1187616901 X:21005648-21005670 AGACTAAAAAAGTGTTGCAGAGG + Intergenic
1188055865 X:25540733-25540755 GTAATAAAAATCTGTGTCAGAGG - Intergenic
1189843008 X:45102113-45102135 ACACTACAAATCTGAGACATTGG + Intronic
1191901627 X:66046653-66046675 ACAGTGAAGATCAGTGGCAGAGG + Intergenic
1193852128 X:86551085-86551107 ACACTAGATATTTGTAGCAGTGG - Intronic
1194318108 X:92407180-92407202 ACACTACAAAACAGTGGAAGTGG - Intronic
1195405658 X:104510280-104510302 ACCCTAAAATTCTCTAGCAGTGG + Intergenic
1196000310 X:110776754-110776776 ACACTATGCATGTGTGGCAGTGG - Intronic
1197253165 X:124235606-124235628 ACACCAAAACTCTGTGGGAAAGG - Intronic
1197824948 X:130579548-130579570 ACATTGAAAATCTGTGGCCTAGG + Intergenic
1197828218 X:130613447-130613469 ACATGAAAAAACTGAGGCAGAGG + Intergenic
1198151196 X:133911997-133912019 TCCCTAATAATCTGTGGAAGTGG + Intronic
1200626280 Y:5520469-5520491 ACACTACAAAACAGTGGAAGTGG - Intronic
1201539713 Y:15092581-15092603 AAACTAAAAATATGTGACAGTGG + Intergenic