ID: 926927161

View in Genome Browser
Species Human (GRCh38)
Location 2:17998771-17998793
Sequence AGGTTTAAACAAATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 530
Summary {0: 1, 1: 3, 2: 46, 3: 112, 4: 368}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926927156_926927161 22 Left 926927156 2:17998726-17998748 CCCAATGATTAAAGGATTGTTTT 0: 1
1: 0
2: 5
3: 28
4: 388
Right 926927161 2:17998771-17998793 AGGTTTAAACAAATGGTGGAAGG 0: 1
1: 3
2: 46
3: 112
4: 368
926927157_926927161 21 Left 926927157 2:17998727-17998749 CCAATGATTAAAGGATTGTTTTG 0: 1
1: 3
2: 36
3: 82
4: 296
Right 926927161 2:17998771-17998793 AGGTTTAAACAAATGGTGGAAGG 0: 1
1: 3
2: 46
3: 112
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926927161 Original CRISPR AGGTTTAAACAAATGGTGGA AGG Intronic
903980424 1:27182863-27182885 AGGTTTGAACAAGTTGTGAAAGG + Intergenic
907258463 1:53197685-53197707 AGATTTAAAAACATGGGGGAGGG - Intronic
907745894 1:57213175-57213197 AGGTACAAAGAAATGGGGGATGG + Intronic
908483522 1:64567885-64567907 AGGGGTAAAACAATGGTGGAGGG + Intronic
909210100 1:72812422-72812444 AGGTGTGAACAAGTTGTGGAAGG - Intergenic
909219256 1:72933848-72933870 AATTTTAAACAAATGGTGTTTGG + Intergenic
910168864 1:84356964-84356986 AGTTTTAATTGAATGGTGGAGGG - Intronic
910614136 1:89178557-89178579 AAGTTCAAATAAGTGGTGGAAGG + Intergenic
912111454 1:106347912-106347934 AGGTTCAAAGAAGTGGTGGAAGG - Intergenic
912219850 1:107660927-107660949 ATGTTCAAACATATGGTTGAGGG + Intronic
913030719 1:114900187-114900209 AAGTTCAAACAAGTGGTGGAAGG - Intronic
913502712 1:119486327-119486349 AGGTTTAAGAAAATTTTGGAAGG - Intergenic
915665853 1:157444338-157444360 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
916012743 1:160720770-160720792 AGCTTTAAGCAAGTGGTAGAAGG + Intergenic
916640353 1:166721777-166721799 AGGTTTGAACAAACTGTAGAAGG + Intergenic
916671173 1:167021992-167022014 AGATTTAAAAAAATTGTGGTTGG + Exonic
917209587 1:172617841-172617863 GGGTTCAAAAAAGTGGTGGAAGG + Intergenic
917232117 1:172849006-172849028 AGATTTAAGCAAGTTGTGGAAGG - Intergenic
917380756 1:174404771-174404793 AGGTTTAAACAAATGCTCTCTGG - Intronic
917556786 1:176098495-176098517 AAGTTCAAACAAGTGATGGAAGG + Intronic
918465178 1:184814115-184814137 AGGTTTGAACAGGTTGTGGAAGG + Intronic
920674051 1:208026801-208026823 AGAATTAAACAAAAGTTGGACGG + Exonic
921374763 1:214462368-214462390 AGTTTATAACAAATGGTGGGAGG - Intronic
921827841 1:219693780-219693802 AAGATTAAACAAATGGTAGGTGG - Intronic
922759505 1:228118002-228118024 AGGTTTAAAGAAATCGTGGAAGG - Intergenic
1063001061 10:1923551-1923573 AGATTTAAAAAATTGCTGGAGGG + Intergenic
1063301854 10:4856241-4856263 AGGTTTAAGCTAGTCGTGGAAGG + Intergenic
1064175215 10:13068933-13068955 AGGTTTAATCAAATGATGAAAGG + Intronic
1065065854 10:21963488-21963510 AGGTTTGAACAAGTTGTGGAAGG + Intronic
1065807427 10:29407674-29407696 AGGTTTAAACAAGTTATGGAAGG + Intergenic
1065978019 10:30860775-30860797 AGGTATAAACAAAAGTGGGAAGG - Intronic
1066083902 10:31958647-31958669 AGGTTTGAGCAAGTTGTGGAAGG - Intergenic
1068348713 10:55816361-55816383 ATGTTTAAACAAATTGTGGAAGG - Intergenic
1068806920 10:61206672-61206694 AGATTTAAAATCATGGTGGAAGG + Intergenic
1068907386 10:62342483-62342505 AGGTTTAAACAAGTTGTGGAAGG - Intergenic
1069493484 10:68881926-68881948 AGATTTAAAAAAAAGGGGGAGGG - Intronic
1069936085 10:71917874-71917896 AAGTTTAAGCAAGTTGTGGAAGG - Intergenic
1070368026 10:75754974-75754996 AGGATTAAATAAATAGTGGATGG + Intronic
1071065221 10:81624835-81624857 AGGTTTAAACAAATATTCCAAGG - Intergenic
1071392180 10:85186944-85186966 AGGCTTAAACAAGTTGTGGAAGG - Intergenic
1072188042 10:93060798-93060820 AGGGTTAAACGACTGGAGGAGGG + Intergenic
1073206451 10:101771855-101771877 TGGTTTAAAAAGAGGGTGGAAGG - Intronic
1073531317 10:104234348-104234370 AGGTTTAAATAAGTTGTGGAAGG + Intergenic
1075505856 10:123021445-123021467 AGGTTTGAACAAGTTGTGGAAGG - Intronic
1076165011 10:128274650-128274672 AGTGTGAAACAAATGGGGGATGG - Intergenic
1076644494 10:131943309-131943331 AGGTTAAAACAAAAAGTAGAAGG - Intronic
1077127698 11:950133-950155 AGTCTTAAACAAATGGTGCTGGG + Intronic
1079235530 11:18686555-18686577 CTGTTTAAGCAAATTGTGGAAGG + Intergenic
1079412705 11:20204306-20204328 AAATTTAAACAAGTTGTGGAAGG + Intergenic
1079664984 11:23093672-23093694 ATGTTTAAGGAAATGGTGGGTGG - Intergenic
1079717663 11:23768968-23768990 AGGTTTAAGCAAGTTATGGAAGG - Intergenic
1079725521 11:23876053-23876075 AAGTTTAAAGTCATGGTGGAAGG - Intergenic
1080058323 11:27930801-27930823 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1080074883 11:28137270-28137292 AGGTTTAAACAAAGAGTGGAAGG - Intronic
1080268930 11:30429826-30429848 AGGATTAAACAAAGGGCTGAGGG - Intronic
1080449192 11:32364638-32364660 AGGATTAAACAAATGAAGTATGG + Intergenic
1080810575 11:35700333-35700355 AGGTTTGAACAAGTTGTGGAAGG - Intronic
1082866583 11:57905296-57905318 AGGTTTAAACAAGTTGTGGAAGG - Intergenic
1082866585 11:57905316-57905338 AGGTTTAAACAAGTTGTGGAAGG - Intergenic
1083001429 11:59295324-59295346 AGGTTTGAGCAAGTTGTGGAAGG - Intergenic
1083011449 11:59404192-59404214 AGGTTTGAACAAGTTGTGAAAGG + Intergenic
1084878463 11:72152077-72152099 AGGCTTGAACAAATTGTGGGAGG - Intergenic
1085275873 11:75299904-75299926 AAGTTTAAAAAGATGGTGGTAGG + Intronic
1085432233 11:76463013-76463035 AGGTTTAAAGAAAGGAGGGAAGG + Intronic
1085480003 11:76813864-76813886 AGGTTTGAACAAGTTGTGGAAGG - Intergenic
1086351455 11:85945964-85945986 AAGTTTACACTCATGGTGGAAGG + Intergenic
1087533358 11:99411761-99411783 ATTTTTAAACAAATAGTGCATGG - Intronic
1087778702 11:102280758-102280780 AGGTTTTAATAAAAAGTGGAAGG + Intergenic
1088104303 11:106188462-106188484 AGGTTTGAACAAGTTGTGAAAGG + Intergenic
1088268743 11:108012289-108012311 AGGTTTAAACAATTGCTGTTTGG - Intronic
1089166743 11:116483318-116483340 AGGAATAAAGAAATGATGGAAGG + Intergenic
1089175150 11:116543317-116543339 ATGTTTAAACAACGTGTGGATGG + Intergenic
1090292473 11:125557473-125557495 AGGTTTGAGCAAGTTGTGGAAGG + Intergenic
1091019308 11:132085094-132085116 AGGTTTAAACAAGTTATAGAAGG - Intronic
1092509648 12:9141592-9141614 AGGTTTAAGCAAGTTTTGGAAGG - Intergenic
1092535788 12:9385884-9385906 TTGTTTCAACAAATGGTGGTGGG - Intergenic
1092563434 12:9640357-9640379 AAGTTCAAACAACTGGTGGAAGG - Intergenic
1092932695 12:13331758-13331780 GGATTTAGACAATTGGTGGAGGG + Intergenic
1092995399 12:13945142-13945164 GGGTCTAAACAAATTGTGGCAGG + Intronic
1093760204 12:22901344-22901366 TGTTTTAAACAAATGGTGTTGGG + Intergenic
1094316588 12:29142730-29142752 AGGTTTAAACAAGTGGAGAAAGG - Intergenic
1096658907 12:53110029-53110051 AGGTTTAAGCAAGTTGTGGAAGG - Intronic
1096923035 12:55110389-55110411 AAATTCAAACAAGTGGTGGAAGG - Intergenic
1097133650 12:56833655-56833677 AGGTTTAAGCAAGTTTTGGAAGG - Intergenic
1097141522 12:56906368-56906390 AGGTTTGAACAAATTGTGGAAGG + Intergenic
1097294080 12:57944303-57944325 AGGTTTAAAAAAAATGTTGAAGG - Intronic
1097601389 12:61696952-61696974 AAGTTTAAACAAGTTGTGGAAGG + Intergenic
1098349350 12:69541094-69541116 AGGTTTAAAAAAATTCTTGAGGG - Intronic
1098438132 12:70490451-70490473 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1098502417 12:71208478-71208500 AGGTTAAAACAAGTTGTGGAAGG + Intronic
1099085225 12:78237941-78237963 GGGTTTAAACTAATGGTTGTTGG + Intergenic
1099244180 12:80174558-80174580 AGGTTTGAGCAAGTTGTGGAAGG + Intergenic
1099355175 12:81625751-81625773 ATGTTTAGAAAAATGTTGGAGGG - Intronic
1100280495 12:93113753-93113775 AGGTTAAAAAAAAATGTGGAGGG + Intergenic
1100326884 12:93548477-93548499 ATTTTTAAAAAAATTGTGGAAGG - Intergenic
1101775851 12:107792931-107792953 AAGTTCAAACAAGTTGTGGAAGG - Intergenic
1105778427 13:23684023-23684045 AGGTTTAAGCAAGTTGTGGAAGG + Intergenic
1106336729 13:28790210-28790232 AGGTTTGAGCACATTGTGGAAGG - Intergenic
1106745107 13:32695147-32695169 AGGTTTAAAAAAATAGTGAGAGG - Intronic
1107071358 13:36273096-36273118 TGATTTAAACAAATTTTGGAAGG - Intronic
1107311621 13:39084249-39084271 AGGTTTGAACAAGTTGTGGAAGG + Intergenic
1108203903 13:48068938-48068960 AAGTTCAAACAAGTTGTGGAAGG + Intronic
1108508072 13:51130958-51130980 AGGTTTGAACAAGTTGTAGAAGG + Intergenic
1108877709 13:55068106-55068128 ACATATAAATAAATGGTGGAGGG - Intergenic
1109293430 13:60501682-60501704 AGGTTTAAGCATTTTGTGGATGG - Intronic
1109346027 13:61115241-61115263 AGGTTTGAACAAGTTTTGGAAGG + Intergenic
1111877106 13:93911100-93911122 AGGTATAAAGAAGTGGTAGATGG + Intronic
1111986683 13:95073055-95073077 AACTTTAAACAGATGGAGGAAGG + Intronic
1113898402 13:113781326-113781348 AGGTTTAAGCAAGTTGTGAATGG - Intronic
1114256520 14:21007019-21007041 AGGTTTAAGCAAGTTGTGGAAGG + Intergenic
1114557287 14:23569274-23569296 AGGTCTAAAGAAAAGGTGGGAGG + Exonic
1114584029 14:23793422-23793444 AGATTTAAACAATTTGTGGAAGG - Intergenic
1115323101 14:32106527-32106549 AGTTTGAAAAAAATGGTGAATGG - Intronic
1115482220 14:33871879-33871901 AAGTTTAAACAAGTTGTGGAAGG + Intergenic
1116103259 14:40467731-40467753 AGGTTTAAGCAAATTGTGGAAGG + Intergenic
1116329729 14:43580275-43580297 AGATTTAAACAAGTTGTGAAAGG + Intergenic
1116483753 14:45421753-45421775 AGGTTTAAACAAATTGTGAAAGG + Intergenic
1118118479 14:62808275-62808297 AGATTTAAACAGGTTGTGGAAGG + Intronic
1118396251 14:65339633-65339655 ATTTTTCAATAAATGGTGGATGG - Intergenic
1118537852 14:66789177-66789199 AGGTTTGAACAAATTGTGGAAGG - Intronic
1118550347 14:66943132-66943154 AAGTTCAAACAAGTGGTAGAAGG - Intronic
1118999398 14:70868308-70868330 AGGCTTAAACAAGTTGTGGAAGG - Intergenic
1119206341 14:72796871-72796893 AGGTTTAGAGAAAAGGAGGAAGG + Intronic
1119822799 14:77633074-77633096 AGGTTTGAGCAAATTGTGGAAGG - Intergenic
1120314916 14:82879407-82879429 AGTTTTGCACAAATGTTGGAGGG - Intergenic
1120411723 14:84165644-84165666 AGGTATACACACATTGTGGAGGG + Intergenic
1120457458 14:84750636-84750658 AGGTTTCAAGAAATGTTGCAAGG + Intergenic
1123026584 14:105427137-105427159 AAGTTTTAACAAATAGGGGATGG - Intronic
1123824295 15:24066027-24066049 CGGTTTGAACAAGTTGTGGAAGG - Intergenic
1124039934 15:26092425-26092447 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1124821358 15:33049052-33049074 AGGTTTCAACAAGTTGTGGAAGG + Intronic
1125062319 15:35438894-35438916 AGGTTTAAACAAGTTGTGGAAGG + Intronic
1125652449 15:41328675-41328697 ATGTTTAAATAAATGTCGGAGGG + Intronic
1125878585 15:43171418-43171440 AGGTCTAAGCAAGTTGTGGAAGG - Intronic
1126214991 15:46144710-46144732 AAGTTTAAACAAGTAGTGGAAGG + Intergenic
1127416943 15:58767471-58767493 AGGTTTTGAAAAATGGTGAAGGG + Intergenic
1128042445 15:64587212-64587234 AGATTTCAACAACTGGTGGGTGG - Intronic
1128750587 15:70146214-70146236 AAGCTTATACTAATGGTGGAAGG + Intergenic
1129922708 15:79333757-79333779 AGCTTTAAACAAAGGGTGTGGGG - Intronic
1131965790 15:97840884-97840906 AGGTTGTAACAGATGGTGGCAGG - Intergenic
1133563022 16:6967216-6967238 ATGTATAAACAAATGGATGATGG - Intronic
1133842378 16:9421444-9421466 AGGTCAAAACAAATGGGAGAGGG - Intergenic
1134852268 16:17489613-17489635 TGGATTAAACGAATGGAGGAAGG + Intergenic
1135036300 16:19079949-19079971 AGGTTTGAACAAGTTGTGGATGG + Exonic
1135207796 16:20497547-20497569 AGGTTTGAACAAATTGTGGAAGG + Intergenic
1135211103 16:20526153-20526175 AGGTTTGAACAAATTGTGGAAGG - Intergenic
1136670190 16:31849664-31849686 AGGTAAAAATAAATGGTGTAAGG + Intergenic
1137330533 16:47490908-47490930 AGGTTCAAACAAGTGGCAGAAGG - Intronic
1137452885 16:48593471-48593493 AGGTTTAAACAAGTTGTGAAAGG + Intronic
1138015400 16:53423656-53423678 AGGCTTAAACAAGTTGTGGAAGG - Intergenic
1138998522 16:62480301-62480323 AGGTTTAAATAAGTTGTGGAAGG + Intergenic
1139002633 16:62531671-62531693 AGGTTTAATCAAATGGATGTTGG + Intergenic
1139183930 16:64781032-64781054 AGGTTTTAACAAATTGTGATGGG - Intergenic
1139305484 16:65982340-65982362 AGGATTAAACAAATGGTAATTGG - Intergenic
1139737161 16:69000957-69000979 AGGCTTAAACAAGTTGTAGAAGG - Intronic
1140028162 16:71311009-71311031 AGGTTTAAAGAGATGGAGGAAGG + Intergenic
1140092142 16:71847083-71847105 AGGTGTACACAAAAGGTGGAAGG - Intronic
1140687655 16:77449049-77449071 CTTTTTAAACAAATGGTAGAGGG + Intergenic
1142523731 17:523062-523084 GGGGTTAGACAAAAGGTGGAAGG + Intronic
1144228111 17:13171722-13171744 AAGTTTAAACAAGTTGTGGATGG + Intergenic
1144555455 17:16278640-16278662 AAGTTTGAACAAGTTGTGGAAGG - Intronic
1144715134 17:17429170-17429192 AGGTTTAAACAAGTTATGGGAGG + Intergenic
1146699773 17:34947241-34947263 ATGTTTAAACAGATAATGGATGG + Intronic
1148632741 17:49124940-49124962 AGGTTTAAGCAATTTTTGGAAGG - Intergenic
1149034424 17:52117866-52117888 AGGTTTAAACACATTGTGGAAGG + Intronic
1149173616 17:53843197-53843219 AGGTTTAAACAAGTTGTAGAAGG - Intergenic
1149212834 17:54323613-54323635 AGCTTTAAGCAAGTTGTGGAAGG - Intergenic
1149224705 17:54455909-54455931 AGGTTTAAACAAGTTGTGGAAGG + Intergenic
1149476907 17:56969754-56969776 AGGTTTAAGCAAGTTGTGGAAGG + Intergenic
1150349010 17:64428004-64428026 AGGTTTCAGCAAGTTGTGGATGG - Intergenic
1151007436 17:70454278-70454300 AGGCTTAAACAACTAGTGAAGGG + Intergenic
1152139391 17:78527476-78527498 AGGTTTAAAAACATGATGAAAGG - Intronic
1152213142 17:79014346-79014368 AGGTCTAAGCAAGTCGTGGAAGG + Intergenic
1153236653 18:2994846-2994868 TGGTTTAAACAGATGGTATATGG + Intronic
1153512033 18:5865507-5865529 ACGTTTGAACAAGTTGTGGAAGG + Intergenic
1155859475 18:30878958-30878980 GATTTTAAACAAATGGTGGTAGG - Intergenic
1156098449 18:33564502-33564524 AGGTTTAAACAAGTGATGGAAGG - Intergenic
1156244963 18:35289461-35289483 AGGTTTGAGAAAATGGTGGGTGG - Intronic
1156972011 18:43167842-43167864 AAGTTCAAACAAGTGGTAGAAGG + Intergenic
1157007686 18:43605318-43605340 AGGTTAAAATAAATGGATGAAGG - Intergenic
1157824806 18:50803208-50803230 GGGTTTAAAAAAATGGTTGAAGG + Intronic
1157953583 18:52068701-52068723 AGGATTAAAGACAGGGTGGAAGG + Intergenic
1158152128 18:54385449-54385471 AGGGTCAAACAAGTGGTGAAAGG - Intergenic
1159431643 18:68360031-68360053 AGGTTTCAACAAGTTGTAGAAGG + Intergenic
1159778319 18:72629747-72629769 AGGATTACATAAATGCTGGATGG + Intronic
1159784173 18:72694091-72694113 AGGTTCAAACAAGGGGAGGAAGG + Intergenic
1159871797 18:73766973-73766995 ACGTTTAAACAAAGGCTGAAAGG + Intergenic
1160470234 18:79125085-79125107 AGTTTTAGTCAAGTGGTGGAAGG + Intronic
1160607560 18:80063729-80063751 AGGTTTGAACAAGTTGTGGAAGG - Intronic
1162711698 19:12599813-12599835 AAGTTTAAGCAAGTTGTGGAAGG + Intronic
1164106739 19:22113873-22113895 TGGTTTAAACAAATTGTGGATGG - Intergenic
1164191517 19:22922379-22922401 AGGTTTGAGCAAGTTGTGGAAGG - Intergenic
1164211686 19:23103246-23103268 AAGTTCAAACAAATGGTGGAAGG + Intronic
1165345443 19:35245911-35245933 TGTTTTCAACAAATGGTAGAGGG + Intergenic
1168027726 19:53655490-53655512 CGGTTTGAACAAGTTGTGGAAGG + Intergenic
1168495678 19:56847308-56847330 AGATTGAGACAAATGGAGGATGG - Intergenic
925471697 2:4169159-4169181 AGGTTTAAGCATATTGTAGATGG - Intergenic
926927161 2:17998771-17998793 AGGTTTAAACAAATGGTGGAAGG + Intronic
927110434 2:19860553-19860575 AGGTTGAGAGAAATGGAGGAAGG + Intergenic
927984424 2:27398267-27398289 TGGTTTAAACAAATAGTGCTGGG + Intronic
928083382 2:28329295-28329317 AGTTTTATACAAATGGGGTAGGG - Intronic
928247095 2:29640007-29640029 TTTTTTAAACATATGGTGGAGGG + Intronic
929264276 2:39900658-39900680 AGGCTTAAGGAAATGGTGGAGGG + Intergenic
930135527 2:47899931-47899953 AAGTTAAAACAAACGGTGGGGGG + Intronic
930151001 2:48059891-48059913 AGGTTTGAACAAATTGTGGAAGG - Intergenic
930498358 2:52177654-52177676 ACGTTTGAACAAGTTGTGGAAGG + Intergenic
931798795 2:65737974-65737996 AGGTATAAGCAAAGGATGGAGGG - Intergenic
932672151 2:73747277-73747299 AGGTATAAACAAGTAGCGGACGG + Intergenic
934931808 2:98432137-98432159 AGGTTTAAACAAATAATGGAAGG + Intergenic
935473641 2:103490629-103490651 AACCTAAAACAAATGGTGGAAGG + Intergenic
935885923 2:107618982-107619004 AGGTTTGAACAAGTTGTGCAAGG + Intergenic
937792062 2:125972368-125972390 TGTTTAAAATAAATGGTGGATGG + Intergenic
938227486 2:129628329-129628351 GGGTTTAGAACAATGGTGGAGGG - Intergenic
938664181 2:133517108-133517130 AGGTTAAGATAAATGGGGGATGG + Intronic
938717469 2:134034061-134034083 AGGTATAAATAAATGGTGGGGGG - Intergenic
939302719 2:140366703-140366725 AGGTTTAGTGAAATGGTGGTTGG + Intronic
939843663 2:147218877-147218899 AGGTTTGAGCAACTTGTGGAAGG - Intergenic
940886807 2:158997231-158997253 AGGGTTAAACAAATAGTGAAGGG + Intronic
940939498 2:159542262-159542284 ATGTTTGAAAAAATAGTGGATGG + Intronic
941097464 2:161255150-161255172 AGCTTTAAAAAAATTGTGGTAGG - Intergenic
941249536 2:163145194-163145216 AGGTTTAAACAAGTGGTGGAAGG + Intergenic
941680224 2:168390161-168390183 AGGGTTAAAAAAATGGAAGAGGG + Intergenic
941853808 2:170210282-170210304 CAGTTTAAACAAATGATGGAAGG - Intronic
942096658 2:172540981-172541003 AGGTTTGAACAAGTTGTGGAAGG + Intergenic
943179670 2:184526555-184526577 AGGTTTAATCAAGTTGTGGAAGG - Intergenic
943419819 2:187656102-187656124 AGGTTCCAACAAGTGGTGGAAGG + Intergenic
943466704 2:188237283-188237305 AGGCTTAAGCAAATGGTGGAAGG + Intergenic
943666218 2:190611618-190611640 AGATTTAAACAAGTTGTGGAAGG - Intergenic
943710215 2:191084638-191084660 AGGTTTAAACAAGTTGTGAAAGG + Intronic
943735502 2:191349188-191349210 AGCTTTAAGGAAATGGTTGAGGG + Intronic
944761634 2:202821515-202821537 TGTTTTAAACAAATGATGAAAGG - Intronic
945704402 2:213211429-213211451 AAGTTTGAACAAGTTGTGGATGG - Intergenic
946096465 2:217278757-217278779 AAGTTTAAAATCATGGTGGAAGG + Intergenic
949061717 2:241963431-241963453 AGGTTTGAACAAATTCTAGAAGG + Intergenic
1168822129 20:781753-781775 AGGTTTAAGCAACTTTTGGAAGG - Intergenic
1169717806 20:8640083-8640105 AGGTTTAAAATAAAGTTGGAAGG + Intronic
1169984690 20:11430749-11430771 ATTTTTAAACAAATGGTGTAAGG + Intergenic
1170440767 20:16376888-16376910 AGGTTTAAAAAAATGATTGCAGG - Intronic
1171163595 20:22951296-22951318 AGGCTTAAACAAAGTCTGGAGGG + Intergenic
1172329958 20:34068608-34068630 ATGTTTAAACATATGGTACATGG - Intronic
1175653496 20:60749236-60749258 TGGCTTAAGCAACTGGTGGATGG + Intergenic
1175703107 20:61154749-61154771 AGGGTTCAACACAGGGTGGAAGG + Intergenic
1177291306 21:19116605-19116627 TGTTTTCAACAAATGGTGCAGGG - Intergenic
1177712100 21:24790401-24790423 AAGTTTAATAAAAGGGTGGAAGG - Intergenic
1178201912 21:30416580-30416602 AGGTTTTAGCAAGTTGTGGAAGG + Intronic
1178466819 21:32856407-32856429 AGGTTTAAAGAAGTTGTGAAAGG - Intergenic
1178853924 21:36235417-36235439 AGGTTTAAACATGTGAAGGAAGG + Intronic
1179414200 21:41185297-41185319 GGGGCTAAACAAATGGAGGAAGG + Intronic
1180242677 21:46521806-46521828 AGGTTTGAGCAAGTTGTGGAAGG - Intronic
1180287074 22:10757292-10757314 AAGTTTGAAATAATGGTGGAAGG - Intergenic
1180577787 22:16796304-16796326 TAATTCAAACAAATGGTGGAGGG + Intronic
1181428812 22:22864196-22864218 AAGCTTACAAAAATGGTGGAAGG + Intronic
1181928740 22:26381707-26381729 AGGTATAAAGAGAAGGTGGAGGG + Intronic
1182384638 22:29927067-29927089 AGTTTTCAACAAACGGTGGTGGG - Intronic
1182936858 22:34231233-34231255 AGGCTTATTCAAATGGTGGCAGG + Intergenic
1183113570 22:35671324-35671346 AGGTTTAAGCAAGTTGTGGAAGG + Intergenic
949464580 3:4331098-4331120 AGGTTTAAGCAAATTGTAGAAGG - Intronic
949812330 3:8019494-8019516 AGGTTCAAACAAGTGGTGAAAGG - Intergenic
949934154 3:9103626-9103648 AGCGTTAAACAAATGGTGTGCGG - Intronic
950197252 3:11017738-11017760 AGGTATAAAGAAATACTGGATGG + Intronic
950605626 3:14077115-14077137 AGGTTTGAATAAGTTGTGGAAGG - Intronic
950640799 3:14346899-14346921 AGGTTTAACCAGCAGGTGGAGGG + Intergenic
951187063 3:19725641-19725663 AGGTCTAAACAGGTTGTGGAAGG + Intergenic
951234354 3:20217361-20217383 AGGTAAAAAGAAATGGTGCAGGG + Intergenic
951256021 3:20450626-20450648 AGGTTTAAACAAGTTGTGGAAGG - Intergenic
951284103 3:20788373-20788395 AGGTTAATACATATGGTGAATGG + Intergenic
951442300 3:22737323-22737345 AGGTTTGAAAACATGATGGAAGG + Intergenic
952294959 3:32053336-32053358 AGGTTTGAGCAAGTTGTGGAAGG + Intronic
953162356 3:40433052-40433074 AGGTTTAAAAAAAGGGTGGGAGG - Intergenic
953416313 3:42720693-42720715 AGGTTTAAGCAAGGGGTGGAAGG + Intronic
953441398 3:42921338-42921360 AGGTTTAAACAAGTTATGGAAGG - Intronic
953647835 3:44771854-44771876 ATGTGTAAACAAGTAGTGGAAGG - Intronic
954598092 3:51844591-51844613 AGGTTCAAACAAGTGGTGGAAGG - Intergenic
955501847 3:59592978-59593000 TGGTTTAAAGGAAAGGTGGAAGG + Intergenic
956576673 3:70759911-70759933 AGTTTTGAACAAATGATGAAGGG + Intergenic
956911783 3:73825808-73825830 TGGATTAAAAAAATGGTGGGTGG - Intergenic
957274945 3:78079152-78079174 AGCTTTAAGCACATGGTAGATGG + Intergenic
957464680 3:80572216-80572238 AGGATTAAAGCAATGGTGGAAGG - Intergenic
957604254 3:82376873-82376895 AGGTTTAAACAAGTTGTGAAAGG - Intergenic
957724708 3:84048845-84048867 AGGTTTGAACAAGTTGTGGAAGG + Intergenic
957737594 3:84223223-84223245 AGGTTTAAGCAAGTTATGGAAGG - Intergenic
958956664 3:100471939-100471961 AGGTTTAAACAAGTTGTAGAAGG + Intergenic
959276993 3:104288339-104288361 AGGTTTAAACAATTTGTAAAGGG - Intergenic
959793888 3:110398348-110398370 AGGTGTGAAATAATGGTGGAAGG - Intergenic
959969219 3:112390016-112390038 AAATTAAAGCAAATGGTGGAAGG + Intergenic
960152138 3:114261154-114261176 AGGTTTGAACAAGTTGTGGAAGG - Intergenic
960382428 3:116980354-116980376 TTGTTTAATCAAATGGTGGGCGG - Intronic
960709104 3:120509329-120509351 AGGTTTGAGCAAGTTGTGGAAGG + Intergenic
961510612 3:127400503-127400525 AGGTTTAAGCAAGTTGTGAAAGG - Intergenic
962947988 3:140189785-140189807 ACTTTTAAACAAATGGATGAGGG - Intronic
963251462 3:143107396-143107418 AGGCTTAACCAAGTTGTGGAAGG + Intergenic
963458364 3:145575776-145575798 ATGTTTAAACAATTTGTGGAAGG - Intergenic
963952669 3:151220298-151220320 AGGTTTAGCAAAATGGTGGTTGG + Intronic
964312952 3:155413881-155413903 ATGTTTATACAAATGGTGTGTGG - Intronic
965341275 3:167494214-167494236 AGATATAAACAAATAGTAGAAGG + Intronic
965588232 3:170338502-170338524 AGGTTTAAACAAGTTATGGAAGG - Intergenic
966271623 3:178114598-178114620 ATCTTTCAACAAATGGTGGTGGG + Intergenic
966465794 3:180229693-180229715 AAGTTCAAACAAGTTGTGGAAGG + Intergenic
966469921 3:180277854-180277876 AGGTTTCCACAAATGGTTAATGG + Intergenic
966536370 3:181039140-181039162 AGGTTTGAACAAGTTGTGGAAGG - Intergenic
966721381 3:183065694-183065716 AGGTTTAAGCAAGTTGTGGAAGG + Intronic
967717681 3:192781883-192781905 AGATATAAACAAATGGTTGGGGG + Intergenic
969634815 4:8361486-8361508 AGGTTTACGCAAGTTGTGGAAGG + Intergenic
970011295 4:11462356-11462378 AGGCAAAAACAAATGGTAGAAGG + Intergenic
970411381 4:15811502-15811524 ACTTTTCAACAAATGGTGCAGGG - Intronic
970838948 4:20443991-20444013 CGAGTTAAACAAATGCTGGAAGG + Intronic
971088987 4:23317478-23317500 AGATTGAAACAAATAATGGAGGG - Intergenic
971650817 4:29270870-29270892 AGTTTTAAACAAATTATGGAAGG + Intergenic
971912450 4:32811250-32811272 AGGTTTACAAAAATGGCAGAAGG + Intergenic
971968948 4:33596951-33596973 AGGTTTAAGCAAGTTGTGGAAGG + Intergenic
972047818 4:34691195-34691217 AGGATTAAACAAATAATGGGGGG + Intergenic
972787749 4:42343516-42343538 ACTTTTAAACAAATGGTGTGGGG + Intergenic
973814010 4:54601951-54601973 ATGTTTGAACAAGTTGTGGAAGG - Intergenic
974203794 4:58673087-58673109 AGATTTAAATAAGTTGTGGAAGG + Intergenic
975043319 4:69771116-69771138 AGGTTTGCACAAGTTGTGGAAGG + Intronic
975247091 4:72131806-72131828 AGGTTTAAACAAATGATGGAAGG + Intronic
975341514 4:73246506-73246528 AGGTTTGCACAAATGGTAGGTGG + Intronic
975412411 4:74069412-74069434 AGGTTTAAGCAAGTTGTAGAAGG - Intergenic
975854348 4:78607382-78607404 ATGTCTAAACAATAGGTGGAAGG - Intronic
976643756 4:87365844-87365866 AGATTTAAAGAAGTTGTGGAAGG + Intronic
977337650 4:95718658-95718680 GGGTATAAAACAATGGTGGAAGG - Intergenic
977592953 4:98847396-98847418 AGGTTTGAACAAGTTGTGAAAGG - Intergenic
977861586 4:101967472-101967494 AGATTTAAACAAATTGAGAAAGG + Intronic
978087944 4:104677586-104677608 AGGTATACACGCATGGTGGACGG - Intergenic
978550635 4:109921968-109921990 AGGTTTAAAAACATGCTGAAGGG + Intronic
978950922 4:114558225-114558247 AGGTTTGAACAAGTTGTGGAAGG - Intergenic
979093232 4:116514861-116514883 AGTTTTAAGCACATTGTGGAAGG - Intergenic
980366124 4:131806903-131806925 AGGTTTAAACAATTGGTGAAAGG - Intergenic
980484174 4:133432760-133432782 AGGTTTACCCATATGATGGATGG - Intergenic
980778568 4:137466862-137466884 AGGTTTGAAAAAATTGTGCAAGG + Intergenic
981201196 4:141981481-141981503 AGGTTTGAACAAGTTATGGAAGG + Intergenic
981323066 4:143415154-143415176 TGGTTTCAACAAATGGTGTTAGG - Intronic
981770395 4:148301445-148301467 AAGTTTAAACAAGTTATGGAAGG + Intronic
981923232 4:150109879-150109901 AAATTAAAACAAAAGGTGGAGGG + Intronic
982213818 4:153063203-153063225 AATTTTAAAAAAAAGGTGGAGGG + Intergenic
982757026 4:159233385-159233407 AGTCTTCAACAAATGGTGGTGGG - Intronic
982864300 4:160490717-160490739 AGGTTTGAACAAGTTATGGAAGG + Intergenic
983043732 4:162959906-162959928 AGGTTGAAAACAATGGTGGTGGG - Intergenic
983262521 4:165472686-165472708 AGGTTTGAGCAAGTTGTGGAAGG - Intronic
983773727 4:171580912-171580934 AGGTTTAAACAAGTTGTGGAAGG - Intergenic
984077297 4:175199049-175199071 ATTTTTAAACAAATGGTGCTGGG - Intergenic
984400635 4:179259549-179259571 AGGTTTGAATAAGTTGTGGACGG - Intergenic
984405517 4:179324713-179324735 TGGCTTAAAAAAAAGGTGGAAGG - Intergenic
984441482 4:179776015-179776037 AGGTTTAAGCAAGTTGTGGAAGG + Intergenic
984985649 4:185326989-185327011 AGGTTTAAGCAAGTTTTGGAAGG - Intronic
987166015 5:15199210-15199232 AGATTTAAACAAGTTGTGGAAGG - Intergenic
988157537 5:27474384-27474406 AAGTTCAAACAAGTTGTGGAAGG + Intergenic
989742282 5:44787745-44787767 ATGTTTGAACAAGTTGTGGAAGG - Intergenic
990290663 5:54347853-54347875 AGGTTTAAACAAGTTGTGGAAGG + Intergenic
990848430 5:60172611-60172633 AAGTTTAAAGAAAGGGTTGAGGG + Intronic
992679356 5:79138488-79138510 AGTATTAAACAAATGGTGTTGGG + Intronic
993171209 5:84421216-84421238 AGATTTATACAACTGGGGGAGGG + Intergenic
993939556 5:94042135-94042157 AGGTTTAAGCAAGTTGTGGAAGG + Intronic
994273095 5:97805389-97805411 AAGTTTAAACAAGTGGTGGAAGG - Intergenic
994327918 5:98470377-98470399 AGGATTAAATAAATGGTGTTGGG + Intergenic
995267057 5:110174336-110174358 TGGTTTGAGCAAATGGTAGAGGG + Intergenic
995431359 5:112081937-112081959 AGTTTTCAACAAATGGTGCTGGG + Intergenic
996111534 5:119571622-119571644 AGGATTAAACAGAAGGTGAAGGG - Intronic
996438925 5:123467419-123467441 AGGCTTAAAAAAATTGTGGTGGG - Intergenic
999362095 5:150993727-150993749 AGGTTCAAACAAGTGGTGGAAGG - Intergenic
999854450 5:155578973-155578995 ATGAATAAACAAATGGTGAATGG + Intergenic
1001278145 5:170365890-170365912 AGGATTCAACAAATGATGGGTGG + Intronic
1002047904 5:176552350-176552372 TGGTTTAGGCAAATGGAGGAAGG + Intronic
1003993684 6:11515476-11515498 AGGTTGACACAAATGTTAGATGG + Intergenic
1004245983 6:13975973-13975995 AGCTTTGGACAAATGGTTGAAGG - Intronic
1004338431 6:14785178-14785200 TGCTTTAAACAAATGGGGGAAGG + Intergenic
1004432473 6:15557318-15557340 AGGTTTGAGCAAATTGTGAAAGG + Intronic
1004615880 6:17288376-17288398 AGGTTTTAAAGAATGGTGGAGGG + Intronic
1006357140 6:33566536-33566558 AGAATGAGACAAATGGTGGAAGG - Intergenic
1006721980 6:36161257-36161279 AGACTTGAGCAAATGGTGGAGGG - Intergenic
1006819553 6:36881347-36881369 AGGTTTGAACAAGTTGTGGAAGG + Intronic
1007552744 6:42742743-42742765 AGGCTGAAACAGATGGTGGAGGG + Intergenic
1007846403 6:44760737-44760759 AGGTTTAAGCAAGTTGTAGAAGG - Intergenic
1008119959 6:47602023-47602045 GGGTTTAAAACAATGGAGGAGGG - Intronic
1008559256 6:52707212-52707234 AGGTTTAAGCAGGTTGTGGAAGG + Intergenic
1008806213 6:55431771-55431793 AGGTTTTTACTCATGGTGGAAGG - Intergenic
1009694389 6:67081804-67081826 ATATTTAAACAAATCGTGAATGG + Intergenic
1009735584 6:67672564-67672586 AGGTTTAAGCAAGTTATGGAAGG - Intergenic
1010103999 6:72146668-72146690 AGGTTTGAACAAGGTGTGGAAGG - Intronic
1010810787 6:80296803-80296825 AGGTTTAAGCCAGTTGTGGAAGG - Intronic
1010872701 6:81062089-81062111 AGGTCTAAATAAATAATGGAAGG - Intergenic
1011590713 6:88967861-88967883 AGGTTTAAACAAGTTCTGGAAGG + Intergenic
1011671670 6:89689307-89689329 AGGTATAAACAAATGGTGTAGGG + Intronic
1012583470 6:100895626-100895648 AAGTTCAAACAAGTGGTGGAAGG + Intergenic
1012594740 6:101025987-101026009 AAGTCTAAACAAGTTGTGGAAGG + Intergenic
1012711679 6:102615288-102615310 AGGTTTGAACAATTTGTGGAAGG + Intergenic
1014163124 6:118193451-118193473 AAGTTTGAACAAGTTGTGGAAGG - Intronic
1014901686 6:126973315-126973337 AGGTTTTAAGAAATGGAGAATGG + Intergenic
1015377664 6:132528966-132528988 AGGTTTGAGCAAGTTGTGGAAGG + Intergenic
1015813354 6:137183409-137183431 AGGTTTAAACAAGTTGTGGGAGG - Intergenic
1015858838 6:137654287-137654309 AGGTTAAAACAAGTGGTGGAAGG + Intergenic
1016108582 6:140192603-140192625 AGGTTTAAACAAGTTGTAGAAGG + Intergenic
1016253946 6:142081119-142081141 CTGTTTATTCAAATGGTGGAAGG + Intronic
1016296286 6:142576697-142576719 AAGTTTAAGCAAGTTGTGGAAGG + Intergenic
1016854528 6:148653508-148653530 AGGTTTAAATAAATTGTGGAAGG + Intergenic
1017404666 6:154106098-154106120 AGATTTAAACAAGCTGTGGAAGG - Intronic
1018065246 6:160120700-160120722 AGGTTCAAACAAGTTATGGAAGG - Intergenic
1018189442 6:161296434-161296456 AGGTTTGAACAAGTTGTGGAAGG + Intergenic
1019069821 6:169335008-169335030 AGGTTTAAGCAAGGTGTGGAAGG - Intergenic
1019968006 7:4516124-4516146 AGGCTTACAATAATGGTGGAAGG - Intergenic
1020835521 7:13145589-13145611 AGGTTAAAAAAAAAGGTGGGGGG - Intergenic
1021321232 7:19214805-19214827 AGGTTCGAATAGATGGTGGAGGG + Intergenic
1022362291 7:29673154-29673176 AGATTTATACAAATGAGGGAGGG + Intergenic
1022428995 7:30297155-30297177 AGATTTATACAAATGAGGGAGGG - Intronic
1022457999 7:30575962-30575984 AGGTTTGAACAAGTTGTGGAAGG - Intergenic
1022579976 7:31541976-31541998 AGGTTTAAGCAAGTTTTGGAAGG - Intronic
1022699105 7:32740591-32740613 AGATTTATACAAATGAGGGAGGG - Intergenic
1022746891 7:33181745-33181767 AGGTTTGAACAAGTTGTGGAAGG - Intronic
1023588511 7:41756513-41756535 AGGTTTAAACAAGTTGTGGAAGG - Intergenic
1023606853 7:41939028-41939050 AGGTTTAAACTCAAGGTGAAGGG + Intergenic
1023704758 7:42930119-42930141 AGAAGTAAACTAATGGTGGAAGG - Intronic
1023812380 7:43921771-43921793 AGGTTTAAACAAGTTGTGGAAGG + Intronic
1023933454 7:44722011-44722033 AGGTTTAAGCAAATTGTGGAAGG - Intergenic
1024437713 7:49378555-49378577 AAGTTCAAACAAGTGGTGGAAGG + Intergenic
1024906634 7:54390032-54390054 AAGTTTAAGCAAGTTGTGGAAGG - Intergenic
1024997514 7:55284159-55284181 AGATTTGAACAAGTTGTGGACGG - Intergenic
1025741149 7:64197012-64197034 AGGTTTAACCAAGTTGTGAAAGG + Intronic
1025769015 7:64486133-64486155 AGGTTTAAACAAGTTGTGGAAGG + Intergenic
1025797172 7:64749338-64749360 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1027808809 7:82865647-82865669 AGTTTTTAAAAAATGGTGAAGGG + Intronic
1028047262 7:86138036-86138058 AAGTTTAAACAAATGGCCTATGG + Intergenic
1029103934 7:98158549-98158571 TGGATTCAACCAATGGTGGATGG + Intronic
1029811000 7:103048779-103048801 AGGTTTGAACAAGTTGTGGAAGG - Intronic
1030144295 7:106337398-106337420 AGGTTTGAACAGGTTGTGGAAGG + Intergenic
1030250079 7:107433583-107433605 TGTTTTCAACAAATGGTGGTGGG + Intronic
1030274693 7:107708254-107708276 AGGTTTAAGCAAGTTGTAGAAGG - Intronic
1031198009 7:118641150-118641172 AGTTTTAAAGAAATGGAAGAAGG + Intergenic
1031735108 7:125349599-125349621 AGGTTTAATCATTTGGTGGTTGG + Intergenic
1031876606 7:127148846-127148868 AGTCTTCAACAAATGGTGCAGGG + Intronic
1032009253 7:128331707-128331729 GGGATTAAAAAAATGTTGGAAGG + Intronic
1032088739 7:128898742-128898764 AGGTTTGAGCAAGTTGTGGAAGG + Intronic
1032251142 7:130258525-130258547 AAGTTTAAACAAGTTATGGAAGG + Intergenic
1033603288 7:142905978-142906000 AGGTTTAAGCAAGTCGTAGAAGG - Intergenic
1033865868 7:145689549-145689571 AAGTTCAAACAAGTGGTGGAAGG + Intergenic
1034731885 7:153394312-153394334 AGGTTTAAGCAAGTTCTGGAAGG + Intergenic
1036392696 8:8338203-8338225 AGGTTAAAACACATGGTACATGG - Intronic
1037392877 8:18413079-18413101 AGCTTTTAACTAATGTTGGAAGG - Intergenic
1039209932 8:35202548-35202570 AGGTCAAAAGACATGGTGGAAGG + Intergenic
1039664933 8:39515320-39515342 AGGTTGTTACAAATGATGGATGG + Intergenic
1040061760 8:43110036-43110058 AGGTTTGAACAAGTTGTGAAAGG - Intronic
1040417956 8:47212851-47212873 AGGTTTAAGCAAGTTGTAGAAGG - Intergenic
1041105139 8:54435325-54435347 AGGTTTCATCTAATGGTGGATGG - Intergenic
1041810282 8:61901196-61901218 AGGTTTAAGCAAGATGTGGAAGG - Intergenic
1042150066 8:65772395-65772417 AGGTTTAAACACATCCTGCAAGG + Intronic
1042403382 8:68375555-68375577 AGGTTTGAAAAAATTGTGAAAGG - Intronic
1043070335 8:75629029-75629051 AGATTTAAACAAGTTGTGGAAGG - Intergenic
1043553625 8:81403971-81403993 TGGTTTAAAAAAATGATGGTAGG + Intergenic
1044032771 8:87258918-87258940 AGGTTTAAACAAGTTGTGGAAGG - Intronic
1044378373 8:91502705-91502727 AGATTTAAGCAAGTTGTGGAAGG - Intergenic
1044439464 8:92206671-92206693 AGGTTTGAGCAAGTTGTGGAAGG - Intergenic
1044658919 8:94576741-94576763 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1044804407 8:95990466-95990488 GGGGTGAAACAAATGGTCGAGGG - Intergenic
1045428414 8:102089763-102089785 AGGTTTAAACAAGTTGTAGAAGG + Intronic
1047581504 8:126221267-126221289 AGGTTTAAACAAGTTTTGGAAGG - Intergenic
1048175827 8:132151429-132151451 AAGTTTAAACAAATGGTGGAAGG + Intronic
1048357620 8:133666609-133666631 AGGTTTGGACAAATGGTGGAGGG - Intergenic
1048686909 8:136914790-136914812 AAGTTTAAACAAGTTGTGGAAGG - Intergenic
1049652199 8:143775984-143776006 AGGTTGAAAAAAATTGAGGAGGG + Intergenic
1050401535 9:5261368-5261390 AGGTTTAAGTAAGTTGTGGAAGG - Intergenic
1050929427 9:11304988-11305010 AAGTTCAAACAAGTTGTGGAAGG + Intergenic
1051148817 9:14058745-14058767 ATGTTTTAACAAATGCTGGAAGG - Intergenic
1051225446 9:14893812-14893834 AGCTTTAAGCAAGTTGTGGAAGG + Intronic
1051653803 9:19357799-19357821 AGTTTTACAAAAATGGTTGAAGG + Intronic
1051829478 9:21259243-21259265 AGGTTTAACCAAGTTGTGGAAGG + Intergenic
1052190249 9:25653195-25653217 AGGTTCAAATAAATGATGTAAGG - Intergenic
1055109245 9:72543188-72543210 TGGCTTAAACAATTAGTGGATGG - Intronic
1057174184 9:92983777-92983799 AGGTTAAAGCAAGTTGTGGAAGG - Intronic
1058355586 9:104080395-104080417 AGGTTTAAACAAGTTGTGGAAGG - Intergenic
1059378917 9:113908340-113908362 CAGTTTAAAAAAATGGAGGAGGG + Intronic
1059566049 9:115383961-115383983 AGGTTCAAACAAGTTATGGAAGG + Intronic
1059790477 9:117636820-117636842 AGGTTTTAAGAAATGGTGCCAGG + Intergenic
1060681666 9:125570759-125570781 AGGTTTAAACAAGTTGTGAAAGG + Intronic
1062305390 9:135903639-135903661 ATCTTTACACAAATGGAGGATGG + Intronic
1185477924 X:426026-426048 AGCTGTAAACAAATGCTGGAGGG - Intergenic
1185478514 X:429268-429290 AGCTGTAAACAAATGCTGGAGGG - Intergenic
1186374425 X:8983140-8983162 AGGTTTAAGCAATTTGTAGAAGG + Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188439844 X:30205180-30205202 AGAGTCACACAAATGGTGGAGGG - Intergenic
1188607261 X:32046642-32046664 AGTTTGAAACAAGTGGTGAAAGG + Intronic
1188762995 X:34055135-34055157 AAATTCAAACAACTGGTGGAAGG + Intergenic
1188993359 X:36851753-36851775 AAGCTTAAAATAATGGTGGAAGG + Intergenic
1189616751 X:42792122-42792144 AAGTTCAAACAAGTGGTGGAAGG - Intergenic
1189844663 X:45123341-45123363 AGGATTTAATAAATGGTGGTGGG - Intergenic
1190386474 X:49886629-49886651 AGGTAAAAGAAAATGGTGGATGG + Intergenic
1190549196 X:51561583-51561605 AGGTTCAAACAAGTGGAGGAAGG - Intergenic
1190566626 X:51736965-51736987 AGTTTTAAACATCTGGTGGAAGG - Intergenic
1190963380 X:55274155-55274177 AGATTTAAACAAGTTGTGGAAGG + Intronic
1191005710 X:55709462-55709484 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1191069746 X:56388020-56388042 AGGTTTGAACAAATTGTGGAAGG - Intergenic
1191189633 X:57652678-57652700 AAGTTCAAACAAGTTGTGGAAGG + Intergenic
1191594841 X:62932169-62932191 AGGTTTAAACAAGTTGTGGAAGG - Intergenic
1191644903 X:63469824-63469846 AAGTTCAAACAAGTGGTGGAAGG - Intergenic
1192413493 X:70955835-70955857 CCTTTTAAACAAATGGTGGTGGG + Intergenic
1192502108 X:71661058-71661080 AGACGTAAACAAATGGTGGTGGG - Intergenic
1192683184 X:73274973-73274995 AGTATTAAACAAATGAGGGAAGG + Intergenic
1192888697 X:75364679-75364701 AGGTTTGAGCAAGTTGTGGAAGG + Intergenic
1193179540 X:78438334-78438356 AAGTTTAAACAAGTTGTAGAAGG - Intergenic
1193523345 X:82557517-82557539 AGGTTTAAGCAAGTTGTGGTAGG + Intergenic
1193705449 X:84815667-84815689 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1193787445 X:85776701-85776723 TGTTTTCAACAAATGGTGGTGGG - Intergenic
1194040770 X:88939629-88939651 AGGTTTAAACAAGTTGTGGAAGG - Intergenic
1194059479 X:89179651-89179673 AGGTTTAAACAAGTTGTGGAGGG - Intergenic
1194810074 X:98378643-98378665 CAGTTCAAACAAGTGGTGGAAGG - Intergenic
1195062593 X:101210743-101210765 AAGTTTAGACAGATGGTTGAGGG + Intergenic
1195197025 X:102508484-102508506 ACCTTTAAACAAATGGTGCTAGG + Intergenic
1195313808 X:103658577-103658599 AGGGCTAAACAAATGGTGAATGG + Intergenic
1195650644 X:107280044-107280066 AGGTTTGAACAAATTGTGGAAGG - Intergenic
1196074330 X:111558368-111558390 AGGTTTAAGCAAGCTGTGGAAGG - Intergenic
1196162148 X:112497743-112497765 AGGTTTGAACAAGTTGTGGCAGG - Intergenic
1196520568 X:116666633-116666655 AGGCTCAAACAAGTGGTGGAAGG - Intergenic
1197066904 X:122244527-122244549 AGGAACAAATAAATGGTGGATGG + Intergenic
1197366001 X:125565639-125565661 AAGTTCAAACAAGTGGTGGAAGG - Intergenic
1197479767 X:126967810-126967832 AAGTTCAAACAAGTAGTGGAAGG + Intergenic
1197481226 X:126989020-126989042 AGGTTTAAGCAAGTTGTGGAAGG + Intergenic
1197509403 X:127352457-127352479 AGGTTTAAACATGTGGTGGAAGG + Intergenic
1197570520 X:128145666-128145688 AGGTTTAAGCGAATTGTGGAAGG + Intergenic
1198181900 X:134218390-134218412 ATGTTTAAGCAAGTTGTGGAAGG - Intergenic
1198195918 X:134361804-134361826 TGTTTTCAACAAATGGTGCAAGG + Intergenic
1198320570 X:135515448-135515470 AGGTGGAAACAAATGGTCCAAGG + Intergenic
1198844660 X:140897993-140898015 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1198855617 X:141012450-141012472 AGGTTTAAGCAACTTTTGGAAGG + Intergenic
1198876517 X:141233746-141233768 AGGTTTAAGCAACTTTTGGAAGG - Intergenic
1198907078 X:141574918-141574940 AGGTTTAAGCAACTTTTGGAAGG - Intergenic
1198909713 X:141599490-141599512 AGGTTTAAGCAAGTTTTGGAAGG + Intronic
1198917373 X:141688656-141688678 AGGTTTAAGCAACTTTTGGAAGG - Intronic
1198939456 X:141936946-141936968 AGATTTAAACAAATGATGGAAGG + Intergenic
1199043653 X:143143365-143143387 AGGTTTAAACAAATGATGAAAGG - Intergenic
1199169522 X:144719465-144719487 AAGTTTAAAGAAGTGGTGGAGGG + Intergenic
1199418758 X:147618744-147618766 AGGTTTAAAAAAATTATGGTTGG - Intergenic
1201951070 Y:19564677-19564699 AGCCTTAAACAAATGGTGTTAGG + Intergenic