ID: 926929790

View in Genome Browser
Species Human (GRCh38)
Location 2:18025122-18025144
Sequence TTGGTTAAGCCCTAGCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926929783_926929790 30 Left 926929783 2:18025069-18025091 CCTAGAGCATGTCCTAGCACTTG 0: 1
1: 0
2: 0
3: 10
4: 174
Right 926929790 2:18025122-18025144 TTGGTTAAGCCCTAGCATCTGGG 0: 1
1: 0
2: 0
3: 9
4: 89
926929784_926929790 18 Left 926929784 2:18025081-18025103 CCTAGCACTTGACAACTCTGTGC 0: 1
1: 0
2: 1
3: 16
4: 167
Right 926929790 2:18025122-18025144 TTGGTTAAGCCCTAGCATCTGGG 0: 1
1: 0
2: 0
3: 9
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926929790 Original CRISPR TTGGTTAAGCCCTAGCATCT GGG Intronic
900577873 1:3393255-3393277 TTGCTTAAGCGACAGCATCTAGG - Intronic
908470321 1:64437647-64437669 TTTGTTAAGCCCCAGCATTTGGG + Intergenic
909050451 1:70761596-70761618 TTGGTTAATATCTATCATCTTGG + Intergenic
909147931 1:71961403-71961425 TTAGTTAAGCCTTACCCTCTTGG - Intronic
914406723 1:147382153-147382175 TTGGTAGAGCCGTAACATCTGGG - Intergenic
920229463 1:204461001-204461023 TTGCTGAAGCCCTATCTTCTGGG + Intronic
923042904 1:230332698-230332720 TCGGTTATTCCCCAGCATCTGGG - Intronic
923163533 1:231338168-231338190 TTTTTAAAGCCCTAGAATCTTGG + Exonic
923484749 1:234418572-234418594 AGGTTTAAGCCCTGGCATCTTGG - Intronic
1063009104 10:2004927-2004949 TTGTTTAAGCCCTGTCATTTTGG - Intergenic
1064791532 10:18961874-18961896 TGGGATATGCCCTAGCTTCTAGG - Intergenic
1073577007 10:104634848-104634870 TTGTTAAAGCTGTAGCATCTAGG + Intergenic
1075097533 10:119482437-119482459 TTGCTTGAGCCCTAGAATTTGGG - Intergenic
1078420043 11:11203285-11203307 TTGCTTCATCCCTAGCAGCTAGG - Intergenic
1080380334 11:31764126-31764148 TAGGTAAAACCCGAGCATCTTGG + Intronic
1082810985 11:57478890-57478912 TTCCTCAAGCCCTAGCATCTAGG - Intergenic
1086015833 11:82166521-82166543 TTTGTTAAGCGGTAGGATCTCGG + Intergenic
1088949686 11:114555012-114555034 TTGTTTAAGTCATTGCATCTTGG + Intronic
1090050199 11:123371240-123371262 TTGGGTAATCCCCACCATCTTGG + Intergenic
1092025922 12:5240399-5240421 TTGGCTAAGCTCTAAAATCTGGG + Intergenic
1099109730 12:78543314-78543336 TTTGCTAAGCCCCAACATCTTGG - Intergenic
1100215563 12:92444694-92444716 TTGTTCAAAGCCTAGCATCTGGG + Intergenic
1102960219 12:117087887-117087909 TTGGCTGAGTCCTAGCCTCTGGG - Intronic
1102984865 12:117269858-117269880 GTGGTCATGACCTAGCATCTAGG + Intronic
1109101964 13:58196852-58196874 TAGGTTATACCATAGCATCTAGG - Intergenic
1114747140 14:25161330-25161352 TTGTTTATGGCCTAGCATATGGG + Intergenic
1117481024 14:56145009-56145031 TAGGTTAAGTCCTGGCTTCTAGG + Intronic
1118445388 14:65846396-65846418 TTGGTTAAGCCCTGCCAACTAGG + Intergenic
1118507504 14:66429544-66429566 TTGCTGAAGCCTTGGCATCTTGG - Intergenic
1123539729 15:21276051-21276073 TTGGTTAATTCCTAACATCCTGG + Intergenic
1127403216 15:58612810-58612832 TGGGTTACTCCCTAGCACCTTGG - Intronic
1130839388 15:87683514-87683536 CTGGTTAATGCCTAGTATCTTGG - Intergenic
1135824725 16:25716590-25716612 TTGTTTAAGCCATATCATTTTGG + Intronic
1140655862 16:77138530-77138552 TTGGTTAAGTTCTTCCATCTAGG + Intergenic
1140744660 16:77970890-77970912 TTTGTTTAACCATAGCATCTAGG + Intronic
1151413101 17:73943989-73944011 TTGGTTTAGGCCTACCATCTGGG - Intergenic
1153356909 18:4147371-4147393 TAGTTAAAGCCCAAGCATCTGGG - Intronic
1153900108 18:9611169-9611191 CTGGTCAAGCTCTAGAATCTTGG - Intronic
1168271165 19:55250585-55250607 TTGAGTAAGCACTAGCAGCTGGG - Intronic
926929790 2:18025122-18025144 TTGGTTAAGCCCTAGCATCTGGG + Intronic
927485572 2:23486342-23486364 AGGGATAAGCCCCAGCATCTCGG - Intronic
929200036 2:39225430-39225452 TTTTTTAATCCCTAGCATCTAGG - Intronic
929653782 2:43708675-43708697 TTGCTCTATCCCTAGCATCTAGG + Intronic
931685603 2:64789603-64789625 TTAGTTAAGCCCTGTCATATCGG + Intergenic
937285994 2:120751662-120751684 TGGGTAATGCCCTAGCATCTTGG + Intronic
942262655 2:174184985-174185007 TTTGTTAAGCCATAGTATTTTGG - Intronic
944218334 2:197277644-197277666 GTGGTTAAGCTCTATCATCTGGG - Intronic
1175340683 20:58227500-58227522 TTGTTCAAGCCCTGGCATCCTGG + Intronic
1176007176 20:62872151-62872173 TTGGTTAAGAAACAGCATCTGGG - Intergenic
1177611504 21:23455343-23455365 TTAGTTAAACCCTTCCATCTAGG + Intergenic
1178756204 21:35352600-35352622 TTGGTTAAGCCAACCCATCTGGG - Intronic
1181788571 22:25245296-25245318 TTGGTCAAGTCCTAGTCTCTGGG - Intergenic
1181820260 22:25469985-25470007 TTGGTCAAGTCCTAGTCTCTGGG - Intergenic
951464285 3:22985545-22985567 TTTGTCCAGCCCTAGAATCTGGG + Intergenic
955371540 3:58356185-58356207 TGTGTCAAGCCCTAGCATGTGGG - Intronic
960658682 3:120034349-120034371 TTGTTTTAGCTCTAGCATTTAGG + Intronic
967843029 3:194022109-194022131 TTGGTTAACACCCAGCATCCAGG - Intergenic
973598501 4:52516819-52516841 TGGGTTAAGCTCTGGCATCTTGG - Intergenic
980722096 4:136711715-136711737 TCAGTTATGCCCTAGAATCTGGG - Intergenic
981497630 4:145411728-145411750 ATGTTGAAGCCCTAGCCTCTAGG + Intergenic
983735423 4:171052907-171052929 TTAGTAAAGCCCTCCCATCTAGG - Intergenic
987178840 5:15345407-15345429 TGGCTTGAGCCCTAACATCTTGG - Intergenic
989416748 5:41186931-41186953 TTGGAAAAGCATTAGCATCTTGG - Intronic
990537758 5:56739786-56739808 TTGTTTGAGCACCAGCATCTAGG + Intergenic
996870307 5:128183933-128183955 TTGGTTGATCCCAAGCATTTGGG - Intronic
1016071055 6:139739695-139739717 TTGGTTTAGAGTTAGCATCTAGG - Intergenic
1024055998 7:45660207-45660229 TTGGTTGATCCTTAGCTTCTTGG + Intronic
1029406144 7:100374947-100374969 TGGGTCAAGCCCTATCACCTGGG + Intronic
1032321242 7:130888203-130888225 TTTGTTAAGACCTAACATGTGGG + Intergenic
1038905399 8:31896594-31896616 TTTGTTAAGACATAGCTTCTTGG + Intronic
1041982500 8:63879214-63879236 TTGGTTAAACACTAGTTTCTTGG - Intergenic
1045300986 8:100909665-100909687 TTGGTTAAGCCACTGCAGCTGGG + Intergenic
1047704249 8:127481793-127481815 TTGCTGTAGCCCTGGCATCTTGG - Intergenic
1049318845 8:141984994-141985016 TTGTGAAAGGCCTAGCATCTTGG + Intergenic
1056561219 9:87731555-87731577 TTGGTTAAGACATAGCCACTGGG - Intergenic
1060506184 9:124199964-124199986 TTGCTTAAGCCCAAGAGTCTGGG - Intergenic
1061416450 9:130449737-130449759 TAGGCTAAGCCCTTCCATCTGGG - Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619949 X:1447822-1447844 TTGGATAAGCACTACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1186449462 X:9660066-9660088 GTGGATAAGCCCAGGCATCTGGG + Intronic
1188438674 X:30192555-30192577 TAGGATATGCCCTAGCAGCTTGG - Intergenic
1195499728 X:105581056-105581078 TGGGTTAAGCCCGTGCTTCTAGG - Intronic
1197253560 X:124239375-124239397 GTGGGTAATCCCTAGCAACTGGG - Intronic
1197562434 X:128040021-128040043 TTGCCTAATCCCTAGAATCTTGG - Intergenic