ID: 926932246

View in Genome Browser
Species Human (GRCh38)
Location 2:18052348-18052370
Sequence CAAGTTCTCCACATTGCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926932246_926932250 -7 Left 926932246 2:18052348-18052370 CCTATAGCAATGTGGAGAACTTG 0: 1
1: 0
2: 1
3: 15
4: 154
Right 926932250 2:18052364-18052386 GAACTTGAGGTAGGGTGAAGTGG 0: 1
1: 0
2: 1
3: 17
4: 337
926932246_926932254 1 Left 926932246 2:18052348-18052370 CCTATAGCAATGTGGAGAACTTG 0: 1
1: 0
2: 1
3: 15
4: 154
Right 926932254 2:18052372-18052394 GGTAGGGTGAAGTGGGAGGGAGG 0: 1
1: 0
2: 12
3: 402
4: 3135
926932246_926932253 -2 Left 926932246 2:18052348-18052370 CCTATAGCAATGTGGAGAACTTG 0: 1
1: 0
2: 1
3: 15
4: 154
Right 926932253 2:18052369-18052391 TGAGGTAGGGTGAAGTGGGAGGG 0: 1
1: 0
2: 6
3: 146
4: 1889
926932246_926932252 -3 Left 926932246 2:18052348-18052370 CCTATAGCAATGTGGAGAACTTG 0: 1
1: 0
2: 1
3: 15
4: 154
Right 926932252 2:18052368-18052390 TTGAGGTAGGGTGAAGTGGGAGG 0: 1
1: 0
2: 2
3: 63
4: 989
926932246_926932255 8 Left 926932246 2:18052348-18052370 CCTATAGCAATGTGGAGAACTTG 0: 1
1: 0
2: 1
3: 15
4: 154
Right 926932255 2:18052379-18052401 TGAAGTGGGAGGGAGGAGAGCGG 0: 1
1: 0
2: 18
3: 201
4: 1960
926932246_926932251 -6 Left 926932246 2:18052348-18052370 CCTATAGCAATGTGGAGAACTTG 0: 1
1: 0
2: 1
3: 15
4: 154
Right 926932251 2:18052365-18052387 AACTTGAGGTAGGGTGAAGTGGG 0: 1
1: 0
2: 1
3: 22
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926932246 Original CRISPR CAAGTTCTCCACATTGCTAT AGG (reversed) Intronic
902663719 1:17923018-17923040 CAAGTTCTCCAGATCTCTAGAGG + Intergenic
905127286 1:35724593-35724615 CAACTTCCCCACATGGCTTTGGG + Intronic
909439752 1:75684531-75684553 CAATTTCTCCACTTTGAAATTGG - Intergenic
910414247 1:86981528-86981550 CAATTTCTCCAAGTTGCAATGGG - Intronic
910599311 1:89013527-89013549 CAAGTACTCAACTTTGTTATTGG + Intronic
910600394 1:89025154-89025176 CAAGTTCTCCTTATTTCTAGAGG - Intergenic
912162486 1:107002585-107002607 CAAGGTCCACACATTGCAATAGG - Intergenic
912166051 1:107044391-107044413 CAATCTCTCCACAGTGCTAGGGG - Intergenic
912585655 1:110762502-110762524 CTAGTTCTCCTTATTGCTTTGGG - Intergenic
913269651 1:117080545-117080567 CAAGTTTTCCACTCTGCTTTGGG + Intronic
913678413 1:121164853-121164875 CAATAACTCCACATTGCTACTGG + Intergenic
914030251 1:143952491-143952513 CAATAACTCCACATTGCTACTGG + Intronic
914159199 1:145115460-145115482 CAATAACTCCACATTGCTACTGG - Intergenic
915269756 1:154745595-154745617 CAACTTCTCCACCTTGCAAATGG + Intronic
916075096 1:161196091-161196113 CAAGTTCACCACAGTGTTAATGG - Intronic
916245853 1:162687402-162687424 CAAGCTCTCAACGTTGCTATGGG - Intronic
916541879 1:165764742-165764764 CAATTTCTTCACATTGCTTTAGG - Intronic
916745773 1:167683916-167683938 CGAGTTGTCCACATTGGCATTGG - Exonic
917651905 1:177086000-177086022 CAAGCTCTCCACAATGCTCCTGG + Intronic
918704184 1:187640514-187640536 AAACTGCTCCACTTTGCTATAGG + Intergenic
919096342 1:193041506-193041528 CAACTCCTACACATTGCTAGTGG + Intronic
919957479 1:202433370-202433392 CCAGGTCTTCACATTGCTATTGG + Intronic
919987387 1:202685367-202685389 CTGATTCTCCACATTGCTAATGG - Intronic
920465718 1:206183377-206183399 CAATAACTCCACATTGCTACTGG + Intergenic
921762532 1:218932513-218932535 AAAATTCTCCAGATTGCTTTTGG - Intergenic
923425955 1:233870115-233870137 CAAGTTGTTCACTTTGCTTTTGG - Intergenic
923852000 1:237806209-237806231 CACCTTCTCGACATTGCTATGGG + Exonic
1063141946 10:3263573-3263595 GAAATTCTCCACATTGCCACTGG + Intergenic
1063426322 10:5952898-5952920 CAGGTTCTCCGCATTCCCATGGG - Exonic
1064091490 10:12389306-12389328 CATGTTCTGCCCATTGCTCTTGG + Intronic
1065421820 10:25553541-25553563 CAGGTTGTTCACATTTCTATGGG - Intronic
1068411649 10:56662898-56662920 CAAGGCCTTAACATTGCTATAGG - Intergenic
1070342689 10:75511995-75512017 GAAGTTCTTCACATTTCTAAGGG + Intronic
1073009497 10:100348324-100348346 CAAGTTCTACACCTGGCTTTGGG + Exonic
1076086491 10:127636923-127636945 CAAGTGATCCACACTGCTGTTGG + Intergenic
1076225804 10:128774245-128774267 CATGTTCTCAACATTTATATGGG - Intergenic
1080901112 11:36492198-36492220 CAAATCATCTACATTGCTATTGG + Intronic
1082294178 11:50417947-50417969 CCATTTATCCCCATTGCTATGGG - Intergenic
1087894234 11:103570367-103570389 CTAGTTCTCCAGATTGCAAATGG - Intergenic
1089121657 11:116139904-116139926 CAAGTCCTCCAAATGGCTTTGGG - Intergenic
1090527201 11:127549597-127549619 CTAGTTTTCCACATTTTTATTGG - Intergenic
1092812139 12:12281415-12281437 CTAGCTCTGCTCATTGCTATTGG - Intergenic
1100097246 12:91055778-91055800 CAGGTTCTCCAGATTGCTAAAGG + Exonic
1100226384 12:92560591-92560613 CCAATACTCCAGATTGCTATAGG - Intergenic
1100391014 12:94146931-94146953 CAAGTTCTCCCCAGTGCTGAGGG - Intergenic
1100809556 12:98324993-98325015 CAAGTGGTCCACATTGGTGTTGG + Intergenic
1105016442 12:132788719-132788741 CAGCTTCTCCCCATTGCCATGGG - Intronic
1109601915 13:64642600-64642622 GAACTTCCCCACATTGCTACTGG - Intergenic
1110612253 13:77502010-77502032 AAAGTTCTCATCATTTCTATGGG + Intergenic
1113777175 13:112954439-112954461 CAGGTCCTCCACATCGCAATGGG - Intronic
1114504521 14:23199033-23199055 CAAGATGTGCCCATTGCTATGGG - Intronic
1116332206 14:43611451-43611473 CAAGTTCTCTGCATGGGTATTGG + Intergenic
1116634308 14:47375914-47375936 CAAGTTTTCCACATGGTAATAGG - Intronic
1118064701 14:62178486-62178508 CATGTTCTTCACATTGCAGTAGG + Intergenic
1121003654 14:90471928-90471950 CAAGGTCTACACACTGCTTTTGG + Intergenic
1124185651 15:27526161-27526183 CAAGCCCTCCACCTTGCTCTGGG - Intronic
1127596779 15:60491743-60491765 CAATGTCTCCACAGTGCAATTGG - Intronic
1129010318 15:72410151-72410173 TAAGTTTTCCACTTTGCTACTGG + Intergenic
1130272586 15:82459737-82459759 CAAGTTCTCCACTGTGGGATGGG + Intergenic
1130408812 15:83627070-83627092 AAAGTCCACCACATTTCTATAGG - Intergenic
1130464938 15:84187090-84187112 CAAGTTCTCCACTGTGGGATGGG + Intergenic
1130487750 15:84407714-84407736 CAAGTTCTCCACTGTGGGATGGG - Intergenic
1130499327 15:84486447-84486469 CAAGTTCTCCACTGTGGGATGGG - Intergenic
1130587228 15:85191704-85191726 CAAGTTCTCCACTGTGGGATGGG + Intergenic
1141863979 16:86737092-86737114 CAAGTTTTCCACAGGGCCATGGG - Intergenic
1141911617 16:87063421-87063443 CCAGTTTTCAAAATTGCTATAGG - Intergenic
1142527439 17:553999-554021 CAAGTACTGCACAGTGCTAAAGG - Intronic
1143329988 17:6126871-6126893 CATGTTCACCACATGGCTGTTGG + Intergenic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1145130809 17:20346614-20346636 CAAGTGGTCCACATTGATATTGG + Intergenic
1145240326 17:21237159-21237181 CAAGTTCTCCGCATTGGGACTGG + Intergenic
1145777980 17:27542814-27542836 CAAATTCTCAGCAGTGCTATGGG + Intronic
1145830354 17:27911256-27911278 AAAGTTGTCCACATGGCTCTGGG - Intergenic
1145966132 17:28919031-28919053 CAAGTTCACCACATTGTCATAGG - Intronic
1146410124 17:32576169-32576191 CAAGTTCTCCAAAGTTCTTTGGG - Intronic
1148984132 17:51606796-51606818 CAAGTTGTTCACTTTGCCATTGG + Intergenic
1149572934 17:57686762-57686784 CAAGTTCTCTGCATTTCTAGTGG - Intergenic
1150070072 17:62142714-62142736 AAAGTTCTACACATGGATATTGG - Intergenic
1152394932 17:80026724-80026746 CAACTGCTCCACACTGCTGTGGG - Intronic
1156435450 18:37123043-37123065 CAAGTTCTACAACTAGCTATTGG - Intronic
1158129816 18:54140072-54140094 CAATTTCTCCACTTTGGAATGGG + Intergenic
1160279151 18:77471023-77471045 CAAATTCTCCACGTGGCTGTTGG + Intergenic
1163218002 19:15894961-15894983 CAAGTCCTCCTCATTGTTCTAGG + Intronic
1166216197 19:41336913-41336935 TAAGGTCTACACATTGCAATTGG + Intronic
1166836092 19:45668963-45668985 CAAGTTCTCCACCAGGCTGTGGG + Intronic
925801213 2:7603270-7603292 CAAGTTCTCACCTTTGCTTTTGG - Intergenic
926932246 2:18052348-18052370 CAAGTTCTCCACATTGCTATAGG - Intronic
927518201 2:23684011-23684033 CAAGTTCTCCAAATGCCAATGGG - Intronic
927681018 2:25139066-25139088 CAAGTTCTCCTCATTGACTTGGG - Exonic
927874727 2:26647722-26647744 CACCTTCTCCACACTGCTGTGGG - Intergenic
928633921 2:33223003-33223025 CATGTTCTCAACATGGCTTTTGG - Intronic
932739045 2:74277671-74277693 CAAGATCTACACATTGATTTTGG - Intronic
934875798 2:97918674-97918696 CAAGGTCTACACATTGCATTTGG - Intronic
934932590 2:98440289-98440311 CAAGATCTCAACTATGCTATGGG - Intergenic
939939690 2:148334825-148334847 CACTTTCTCCACATAGATATTGG - Intronic
941992369 2:171569705-171569727 GAAGTTGTCCACCTTGCTTTTGG - Intergenic
942232256 2:173871451-173871473 CAAGCTCTAGACATTACTATTGG - Intergenic
942778948 2:179617881-179617903 CAAGTTCTCAAGATTCTTATGGG - Intronic
944876559 2:203968330-203968352 TTAGTTCTGCTCATTGCTATTGG + Intergenic
945019093 2:205553172-205553194 CAAGAACTCCACATTGCTATAGG - Intronic
945059492 2:205896358-205896380 CAGTGTCTCCACCTTGCTATTGG + Intergenic
945804769 2:214477245-214477267 GAATTTCCCAACATTGCTATAGG - Intronic
945865845 2:215174621-215174643 AAAGTTCTCCTCACTTCTATGGG + Intergenic
945984679 2:216344052-216344074 CAAATTCTCTACATTGCTAATGG - Intronic
946502734 2:220267073-220267095 TAAGACTTCCACATTGCTATAGG - Intergenic
948956055 2:241292431-241292453 GAAGGTCTCCACATTGCATTTGG - Intronic
1170791335 20:19511872-19511894 CATTCTTTCCACATTGCTATTGG + Intronic
1177183225 21:17765953-17765975 CAAGTGCTCTTCATTGCTTTGGG - Intergenic
1179640999 21:42747228-42747250 CAGGGTCCCCACATTGCTACAGG - Intronic
949940588 3:9151345-9151367 CACGTTCTCCACATTGTTGATGG - Intronic
955805960 3:62734846-62734868 GATGTTTTCTACATTGCTATGGG - Intronic
957416107 3:79907585-79907607 CAATTTCTTCAGATTCCTATGGG + Intergenic
957982824 3:87532762-87532784 TATGTTTTCCACATTTCTATGGG + Intergenic
958798284 3:98729862-98729884 CAGGTTCCCCACATTACCATGGG - Intergenic
965994673 3:174865905-174865927 AAAATTCTCTACTTTGCTATAGG + Intronic
966074039 3:175914744-175914766 CACCTTCTCCATATTGCTATAGG + Intergenic
967842342 3:194016669-194016691 CAAGTGCCCCATATTTCTATTGG - Intergenic
970311579 4:14787783-14787805 CAAGTTCTCCACATGGCACTAGG - Intergenic
971837839 4:31791738-31791760 CAATTCCACCACATTGCTATTGG - Intergenic
972015439 4:34237461-34237483 CAAGTTCTCCAAGATGCTAGGGG + Intergenic
973822236 4:54672107-54672129 CAAGATCTACACATTGTAATTGG + Intronic
973835344 4:54803750-54803772 CAAGTTCTCCTCACTCCCATGGG + Intergenic
975574272 4:75847463-75847485 TAAGTTCTACACATTGCAATTGG + Intergenic
981966872 4:150614276-150614298 CAATATCTCCCCATTGCTATAGG - Intronic
983821124 4:172194317-172194339 CAAGTTCTCCAATTTGTTGTTGG - Intronic
983915350 4:173286241-173286263 CAAGTTCTCCAGTTTCCTTTGGG + Intronic
989323070 5:40159622-40159644 CTAGTTCTCCTTATTGCTTTGGG + Intergenic
991627427 5:68618444-68618466 CAAGTTCTCCATTATGCCATAGG + Intergenic
991947789 5:71916448-71916470 CAAGTGGTCCACATTGGTATTGG - Intergenic
992280059 5:75165597-75165619 CAAGGTATGCTCATTGCTATTGG - Intronic
993664874 5:90683707-90683729 CAATATCTCCACAGTGATATTGG - Exonic
993821855 5:92629555-92629577 CAAGTTCTCATCATTGATACTGG + Intergenic
993971890 5:94429831-94429853 CAAGTTCTCTACACAGGTATGGG + Intronic
1002076345 5:176710728-176710750 CAAGTTCTCAGGATTGCTTTGGG + Intergenic
1003493694 6:6645564-6645586 CAAATTCTACAAATTGCTGTAGG - Intronic
1006304589 6:33211467-33211489 CAATTTCTCCACCTGGCTCTGGG - Exonic
1007163053 6:39808373-39808395 CAAGTGCTTCTCATTGCTACAGG + Intronic
1009823126 6:68830399-68830421 CAAGTTCTATATATTGCTTTTGG - Intronic
1017161732 6:151371782-151371804 CCCATTCTCCACATTACTATTGG - Intronic
1018646695 6:165955179-165955201 CAAGTTCTCCACATAGCCCGAGG + Intronic
1021237969 7:18166496-18166518 CATGTACTCTACATTTCTATGGG - Intronic
1026255033 7:68703711-68703733 CAATGTCTCCACATTGCCCTTGG - Intergenic
1028276545 7:88864713-88864735 CCAGTTCTTCCCATTGCTTTCGG - Intronic
1029526491 7:101097783-101097805 CCATTTCTCTACATTGCCATGGG + Intergenic
1034532396 7:151704456-151704478 CTGTTTCTCCACATTGCTGTAGG + Intronic
1034988529 7:155533062-155533084 CAAGCTCTGCACATCGCTAGAGG + Intronic
1041268528 8:56088229-56088251 CCAGTTGTGCTCATTGCTATTGG - Intergenic
1044541662 8:93415208-93415230 CAATTTATCCTCATTGCCATAGG - Intergenic
1046816603 8:118591082-118591104 AATGTTCTCCACCTTGCTTTTGG + Intronic
1048736891 8:137512077-137512099 CAAGTTCTCTTCATTTTTATTGG + Intergenic
1049210795 8:141385607-141385629 CAAATTCTCCAAATTGTTCTTGG + Intergenic
1050758790 9:9040454-9040476 CAAATTCTGCACATTTATATTGG + Intronic
1051494721 9:17707088-17707110 CAAGTTCCCCCCATTACTGTAGG - Intronic
1052010466 9:23402028-23402050 TAAGTTCTCCTCATTGCAAATGG - Intergenic
1052852219 9:33385275-33385297 CCAGTTCTCCCCATTGCTGCAGG + Exonic
1053680321 9:40481826-40481848 CAAGTTCTCCCCATCGCTGCAGG + Intergenic
1053930308 9:43110136-43110158 CAAGTTCTCCCCATTGCTGCAGG + Intergenic
1054283391 9:63143109-63143131 CAAGTTCTCCCCATCGCTGCAGG - Intergenic
1054293401 9:63317336-63317358 CAAGTTCTCCCCATCGCTGCAGG + Intergenic
1054391427 9:64621829-64621851 CAAGTTCTCCCCATCGCTGCAGG + Intergenic
1054504300 9:65894498-65894520 CAAGTTCTCCCCATCGCTGCAGG - Exonic
1056990980 9:91410660-91410682 CATCTTGTCCACATTGCTACTGG + Exonic
1057910740 9:99018221-99018243 CAAGGTCTACACATTGCATTTGG + Intronic
1058817022 9:108693812-108693834 CACGTTCTCCCCATTGCCCTTGG - Intergenic
1186924803 X:14321895-14321917 AAAGTTCTCCATAATGCTGTAGG - Intergenic
1189414249 X:40801003-40801025 CAAGTTCTCCAATTTCCTCTGGG + Intergenic
1193666395 X:84323964-84323986 CAATTTCTCCACTTTGCAAGTGG - Intronic
1196717197 X:118823475-118823497 AAAGTTCTTCACCTTGGTATAGG - Intergenic
1198812743 X:140552104-140552126 CAAGATGTACACATTGCAATTGG + Intergenic
1199664678 X:150087303-150087325 AAGGTTCTCCTCATAGCTATTGG - Intergenic