ID: 926938264

View in Genome Browser
Species Human (GRCh38)
Location 2:18108007-18108029
Sequence CTGGAGGCATAGGTTTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 331}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926938264 Original CRISPR CTGGAGGCATAGGTTTTTGA GGG Intronic
900700176 1:4043122-4043144 CTGGATTCATTGATTTTTGAAGG - Intergenic
901148516 1:7084688-7084710 CAGGAGGCATATGTGTTTGCGGG + Intronic
904014232 1:27407813-27407835 CTGAGGGCACAGGTTTTAGAAGG + Exonic
904212034 1:28892243-28892265 CTGTTGGCATGGGTTTTGGAGGG - Intronic
905141186 1:35846161-35846183 GGGGAGGAATAGGTTTTGGATGG - Intronic
906220285 1:44072899-44072921 CTAGAGAAATAGGTGTTTGAAGG + Intergenic
906451636 1:45954304-45954326 CTGGAGGGAGGGGTTTTTGAAGG + Intronic
908683233 1:66685470-66685492 CTGGAGGCAAAGAGTTTTGTTGG + Intronic
908866167 1:68550905-68550927 CTGGATTCATTGATTTTTGAAGG - Intergenic
909181367 1:72427971-72427993 CTGGATTCATTGATTTTTGAAGG + Intergenic
911217688 1:95213641-95213663 CTGGATTCATTGATTTTTGAAGG + Intronic
911899463 1:103484498-103484520 CTGGATTCATTGATTTTTGAAGG - Intergenic
911990980 1:104696306-104696328 CTGGATTCATTGATTTTTGAAGG - Intergenic
912111824 1:106351921-106351943 GTGGAGTTATAGGTTTTGGAGGG - Intergenic
912425238 1:109582544-109582566 CTTGAAGTATAGGTCTTTGAAGG - Exonic
912936829 1:114010931-114010953 GTGGAGGCATTGGGTTCTGAGGG + Intergenic
913710705 1:121480270-121480292 CTGGATTCATTGATTTTTGAAGG - Intergenic
914807316 1:151001213-151001235 CTGCAGGCATAGGGGTTTGCAGG - Intronic
915247913 1:154569111-154569133 CTTGAGTCATAGGTATTTGCTGG + Intronic
915484166 1:156208558-156208580 CTGGAGGCATGGGCATGTGATGG - Intronic
915498576 1:156298753-156298775 CTGGAGGCATTGCTCTTTCAGGG + Exonic
915532806 1:156513180-156513202 CTGGAGGAAGAGGTTCCTGAAGG - Intergenic
916614567 1:166426406-166426428 CTGGATTCATTGATTTTTGAAGG + Intergenic
916782601 1:168051952-168051974 CTGGAGGCAGAGGTTGTAGTGGG - Intronic
916836166 1:168547705-168547727 CTGGATTCATTGATTTTTGAAGG - Intergenic
917084299 1:171290887-171290909 CTGGAGGCAAAGGTCTTTGGTGG + Intergenic
918227033 1:182493439-182493461 CTGGAGGCTGAGATTTGTGAAGG + Intronic
918536492 1:185580776-185580798 CTGGATTCATTGATTTTTGAAGG + Intergenic
918943484 1:191030367-191030389 CTGGACTCATTGATTTTTGAAGG - Intergenic
919381276 1:196864556-196864578 CTGGATGCATTGATTTTTGAAGG - Intronic
919510084 1:198451573-198451595 CTTGAATCTTAGGTTTTTGAAGG + Intergenic
920495676 1:206453447-206453469 CTGGAGCCATAGGACTATGAGGG + Intronic
922826395 1:228523645-228523667 CTGGATTCATTGATTTTTGAAGG + Intergenic
923775468 1:236974480-236974502 CTGGAGTGATGGGTTTTTGAAGG - Intergenic
924681763 1:246242044-246242066 CTGGATTCATTGATTTTTGAAGG + Intronic
1062837280 10:643964-643986 CTGGAATCATAGGATTTAGAGGG - Intronic
1063941071 10:11129828-11129850 CTGGATTCATTGATTTTTGAAGG + Intronic
1065450302 10:25849494-25849516 CTGGAGGCATGGGGTAGTGAGGG + Intergenic
1066595698 10:37047485-37047507 CTGGATTCATTGTTTTTTGAAGG + Intergenic
1067688050 10:48479588-48479610 CTGGAGGCAAGGGTTCTAGAGGG + Exonic
1067865421 10:49900650-49900672 TTGGAGGCATAGGATAATGAGGG - Intronic
1068472865 10:57487344-57487366 CTGGATTCATTGCTTTTTGAAGG + Intergenic
1068932452 10:62605714-62605736 CTGGATTCATTGATTTTTGAAGG + Intronic
1070478040 10:76849399-76849421 CTGGATTCATTGATTTTTGAAGG - Intergenic
1070689996 10:78517478-78517500 TTGGAGGGATGGGTTTTTGGGGG + Intergenic
1071084004 10:81846987-81847009 CTGGAGCCATACGGCTTTGATGG - Intergenic
1072148545 10:92666000-92666022 ATGGAGGAATAGGTTTTTAGAGG + Intergenic
1075358932 10:121812027-121812049 CTGGAGGCAAAGGTTGTAGTGGG - Intronic
1075898596 10:126019783-126019805 CTGCAGGCAGAGGCTTCTGAGGG + Exonic
1076177504 10:128379433-128379455 CTGGAAGCATAAGTGTGTGAGGG + Intergenic
1076414882 10:130278735-130278757 CTGTAGGCAGAGTTTTCTGATGG - Intergenic
1076832985 10:133006258-133006280 CTGGAGACACAGGGTTTTGTGGG + Intergenic
1076995825 11:297118-297140 CTGGAGGCAGAGGTGTGTGGAGG - Intergenic
1079563303 11:21849862-21849884 CTGGATTCATTGATTTTTGAAGG - Intergenic
1079833772 11:25305429-25305451 CTGGATTCATTGATTTTTGAAGG + Intergenic
1079993454 11:27270859-27270881 CTGGATTCATTGATTTTTGAAGG + Intergenic
1080150677 11:29048718-29048740 CTGGATTCATTGATTTTTGAAGG + Intergenic
1080815981 11:35757454-35757476 CTGGATTCATTGATTTTTGAAGG + Intronic
1081335531 11:41861429-41861451 AGGAAGGCAAAGGTTTTTGAAGG - Intergenic
1081793841 11:45806187-45806209 CTTGAGGCAGAGGTTATTGAAGG - Exonic
1082291984 11:50387034-50387056 CTGGATTCATTGATTTTTGAAGG - Intergenic
1083133375 11:60647637-60647659 CTGCAGGCCTTGGTTTTTCACGG - Intergenic
1087369415 11:97263353-97263375 CTCTAGGCATAGCTGTTTGATGG + Intergenic
1087616492 11:100491869-100491891 CTGGATTCATTGATTTTTGAAGG - Intergenic
1088217807 11:107533155-107533177 CTGAAGTCTTTGGTTTTTGATGG - Intronic
1088903748 11:114138303-114138325 ACAGAGGCATAGGTTTTTGGAGG + Intronic
1092079272 12:5700626-5700648 CTGGATTCATTGCTTTTTGAAGG - Intronic
1092938511 12:13386161-13386183 CTGGAGACATGGCTGTTTGAGGG + Intronic
1093802643 12:23392161-23392183 CTGGATTCATTGATTTTTGAAGG - Intergenic
1094135123 12:27117182-27117204 CTGGATTCATTGATTTTTGATGG + Intergenic
1096935773 12:55273201-55273223 CAGAAGGCATAAGTTTTTTATGG + Intergenic
1097406637 12:59197743-59197765 CTGGTAGCATGGGTTTATGAGGG - Intergenic
1098182881 12:67866815-67866837 CTGGATTCATTGATTTTTGAAGG + Intergenic
1099880723 12:88464093-88464115 CTGGATTCATTGATTTTTGAAGG + Intergenic
1100624703 12:96318985-96319007 CTGGATTCATTGATTTTTGAAGG - Intronic
1100971553 12:100076465-100076487 CAGGAGGCAGAGGTTGTTGTGGG - Intronic
1101487660 12:105181917-105181939 CTGGATTCATTGATTTTTGAAGG + Intronic
1103038089 12:117672696-117672718 CTGGAGGCAGAGGTTGTGGTGGG - Intronic
1104637997 12:130449924-130449946 CTGGAGGCAGAAGTTTGAGATGG - Intronic
1104719735 12:131038652-131038674 CTGGAGGCAGAGGTGATGGAGGG + Intronic
1106959870 13:34985990-34986012 CTGGATTCATGGTTTTTTGAAGG + Intronic
1108547714 13:51512658-51512680 CTGGATTCATTGATTTTTGAAGG + Intergenic
1108549517 13:51529547-51529569 CTGGATTCATTGATTTTTGAAGG - Intergenic
1108576317 13:51794657-51794679 CTGGAGTTATGGGTTTTAGAGGG - Intronic
1109816501 13:67591559-67591581 CTGGATTCATTGATTTTTGAAGG - Intergenic
1109927320 13:69161093-69161115 CTGGATTCATTGATTTTTGAAGG - Intergenic
1111862099 13:93720521-93720543 CTGGATTCATTGATTTTTGAAGG + Intronic
1112302058 13:98239710-98239732 CGGGTGGCATTGGTTATTGAAGG + Intronic
1113033253 13:106017673-106017695 ATGGAGGCAGAGGCTTTGGAGGG - Intergenic
1114053136 14:18940491-18940513 CTGAAATCATAGGTATTTGATGG + Intergenic
1114109422 14:19461435-19461457 CTGAAATCATAGGTATTTGATGG - Intergenic
1114810127 14:25889344-25889366 CTGTAGGGATATGTTTTTGGAGG - Intergenic
1115924496 14:38415670-38415692 CTGGATTCATTGATTTTTGAAGG - Intergenic
1115927500 14:38451907-38451929 CTGGATTCATTGATTTTTGAAGG - Intergenic
1116902964 14:50379169-50379191 CTGCTGGCATAGCTCTTTGAAGG + Intronic
1119401195 14:74363838-74363860 CTGGAGGAAGAGGATTTTGGTGG + Intergenic
1120105352 14:80488062-80488084 CTGGATTCATTGATTTTTGAAGG - Intronic
1120463163 14:84822665-84822687 CTGGAAGCAAATGTTTGTGAAGG + Intergenic
1121338389 14:93090877-93090899 CTGGAGGCGCAGGTTGGTGATGG - Intronic
1121675651 14:95750591-95750613 TTGGAGGCATAGGTGTTGCAGGG + Intergenic
1122807732 14:104269055-104269077 CTGGAGTTACAGGTTTTTGAAGG + Intergenic
1123118299 14:105904642-105904664 TTCCAGGCATGGGTTTTTGATGG + Intergenic
1123221310 14:106858854-106858876 CTGGATTCATTGATTTTTGAAGG + Intergenic
1124703119 15:31934800-31934822 TTTGAGGAATAGGTTTGTGAGGG + Intergenic
1126672925 15:51132796-51132818 CTGGACGCAGAGCATTTTGAGGG - Intergenic
1128895575 15:71370237-71370259 CTGGATTCATTGATTTTTGAAGG + Intronic
1134047869 16:11114574-11114596 CTGCAGGCAGAGGCTTTAGAGGG + Intronic
1138843360 16:60536247-60536269 CTGGATTCATTGATTTTTGAAGG + Intergenic
1138993924 16:62425183-62425205 TTGGAGGCCTGGGTTTTTCAAGG - Intergenic
1141403188 16:83769075-83769097 GTTGAGGCTTGGGTTTTTGAGGG + Intronic
1141751688 16:85962525-85962547 TAGGAGGCCTGGGTTTTTGAAGG - Intergenic
1142934417 17:3316076-3316098 CTGGGGGGACAGGTTGTTGATGG - Intergenic
1145890489 17:28411521-28411543 AAGGAGGCATAGGTTTTGGGTGG - Intergenic
1146162136 17:30565770-30565792 CTGGAGACATAGTCTTCTGAGGG + Intergenic
1148009425 17:44463937-44463959 ATGAAAGCAGAGGTTTTTGAGGG - Intronic
1148105086 17:45114686-45114708 CAGGAGGAACAGGTTGTTGAAGG - Intronic
1148821663 17:50363604-50363626 CTGGAGGCTTGGGTTTTTTGAGG + Intergenic
1149061231 17:52424679-52424701 CTGGATTCATTGATTTTTGAAGG + Intergenic
1149618604 17:58023617-58023639 CTTGATGCCTTGGTTTTTGATGG + Intergenic
1151007257 17:70451909-70451931 CTGGATTCCTAGGTTTTTGGGGG + Intergenic
1154949663 18:21196815-21196837 CTGGAAGCATAGGATTGTGATGG - Intergenic
1155144010 18:23068674-23068696 TTGGAGGCCAAGGTTTTTCAAGG - Intergenic
1155711006 18:28879201-28879223 CTGGATTCATTGATTTTTGAAGG - Intergenic
1156283579 18:35667100-35667122 CAGGAGGCAAAGATTGTTGACGG - Intronic
1156716686 18:40020926-40020948 CTGCAGGCAAAGGTTTTTAAAGG - Intergenic
1157586841 18:48806467-48806489 CTGGGGGCATAGCGTTTGGATGG + Intronic
1159011744 18:63064552-63064574 CTGCAGGCATAGGACTCTGAAGG - Intergenic
1159251320 18:65880724-65880746 CTGCAGACATATGCTTTTGAAGG + Exonic
1160603191 18:80030125-80030147 CTGGAGGCAAAGGTCTTTGGTGG - Intronic
1166778286 19:45325584-45325606 CGGGAGGCAGAGGTTTCTGCGGG + Intergenic
925245019 2:2374391-2374413 CTGGATTCATTGATTTTTGAAGG + Intergenic
925718559 2:6807068-6807090 CTGGAGGCATAGGATGTGCAGGG + Intergenic
926871414 2:17422096-17422118 CAAGAGGCTTAGGTTTTTTAAGG + Intergenic
926938264 2:18108007-18108029 CTGGAGGCATAGGTTTTTGAGGG + Intronic
927739887 2:25559395-25559417 CTGGAGGTCTAGTTGTTTGAGGG - Intronic
928800576 2:35085792-35085814 TTGCAGGCATATATTTTTGAAGG + Intergenic
930102760 2:47615956-47615978 CTGGGTGCATTGGTTGTTGAGGG + Intergenic
931538811 2:63305935-63305957 CTGGATTCATTGATTTTTGAAGG - Intronic
932959361 2:76394835-76394857 CTGGAGGGCAAGGTTTTTGTAGG - Intergenic
933202707 2:79469065-79469087 CTGGATTCATTGATTTTTGAAGG - Intronic
935014978 2:99173265-99173287 CTGGGGGCACTGGCTTTTGAGGG + Intronic
936823800 2:116555968-116555990 CTGGATTCATTGATTTTTGAAGG - Intergenic
937528030 2:122795210-122795232 TTGGAGGTATGGATTTTTGATGG - Intergenic
937852810 2:126650657-126650679 CTTGAGAAATAGATTTTTGAGGG - Intergenic
938147825 2:128852125-128852147 CTGGATTCATCGATTTTTGAAGG - Intergenic
938471123 2:131563037-131563059 CTGAAATCATAGGTATTTGATGG + Intergenic
938559159 2:132455436-132455458 CTGGAGTCATTGAATTTTGAAGG + Intronic
939947272 2:148425070-148425092 CTGGATTCATTGATTTTTGAAGG - Intronic
940616084 2:156050270-156050292 CTGGATTCATTGATTTTTGAAGG - Intergenic
940757891 2:157704498-157704520 CTGGTGGCATAGGCATTGGAGGG - Intergenic
940964081 2:159818373-159818395 CTGGGGTTATAAGTTTTTGAGGG - Intronic
941571353 2:167174569-167174591 CTGGATTCATTGATTTTTGAAGG + Intronic
942467218 2:176221117-176221139 CTGGATTCATTGATTTTTGAAGG + Intergenic
947910683 2:233798925-233798947 TGGGAGGCAGAGGCTTTTGATGG + Intronic
949015147 2:241704793-241704815 CTGGGGGCAGAGGGTTTTGAGGG + Intronic
1168801338 20:645343-645365 CTGGGGGCAGAGGTTTTTTTGGG + Intergenic
1171772399 20:29333642-29333664 CTGGATTCATTGATTTTTGAAGG - Intergenic
1173237160 20:41257101-41257123 CTGGAGGCATTTGTAGTTGAAGG - Intronic
1174837605 20:53873088-53873110 CTGGAGTCAGAGGTTTATGGAGG + Intergenic
1175661657 20:60818276-60818298 CTGGACGCATTGGTTCTTTATGG - Intergenic
1178037619 21:28602489-28602511 CTGGAGGCATAGTCTTTGAATGG - Intergenic
1179433077 21:41338422-41338444 CTGTAGGCATAGGTGTCAGATGG - Exonic
1180471609 22:15662866-15662888 CTGAAATCATAGGTATTTGATGG + Intergenic
1180628510 22:17210669-17210691 CTGGAGGCGGAGGTTGTAGAGGG - Intronic
1181189768 22:21129679-21129701 CTGGCGGCATAGGTACTGGAAGG + Intergenic
1181209436 22:21280830-21280852 CTGGCGGCATAGGTACTGGAAGG - Intergenic
1181708035 22:24660806-24660828 CTGGCGGCATAGGTACTGGAAGG + Intergenic
1184709641 22:46241193-46241215 GTTGAGGCCTAGGTTTTTGCTGG + Exonic
1184982993 22:48107420-48107442 ATGGAGGTGTAGGTTTTTGGAGG - Intergenic
1203217511 22_KI270731v1_random:14615-14637 CTGGCGGCATAGGTACTGGAAGG + Intergenic
949175761 3:1060767-1060789 CTGGATTCATTGATTTTTGAAGG + Intergenic
949801249 3:7906457-7906479 CTGGTGGCATAGGCATCTGAGGG + Intergenic
950302894 3:11897382-11897404 CTGGATTCATTGATTTTTGAAGG - Intergenic
953047183 3:39304547-39304569 CTGGTGGCATAGGCGTCTGAGGG - Intergenic
953100443 3:39820458-39820480 CTGGAGACAGAGGTTTTCAAGGG - Intronic
953784385 3:45899705-45899727 CTGTGGGCAGAGGTTTTGGAAGG + Intronic
955453672 3:59097465-59097487 CTGGATTCATTGTTTTTTGAAGG + Intergenic
955744315 3:62124962-62124984 CTGGAGTCAGGGGTCTTTGAAGG + Intronic
955890830 3:63648365-63648387 CTGGATTCATTGATTTTTGAAGG - Intergenic
955895707 3:63697427-63697449 CTGGATTCATTGATTTTTGAAGG - Intergenic
957533496 3:81471121-81471143 CTGAAGACATAGATTTATGAGGG - Intergenic
957640203 3:82843860-82843882 CTGGACTCATGGTTTTTTGAAGG - Intergenic
957721695 3:84010786-84010808 CTGGATTCATTGATTTTTGAAGG - Intergenic
958687128 3:97413166-97413188 CTGGAAGAGTAGTTTTTTGAAGG - Intronic
959256499 3:104021745-104021767 CTGGATTCATTGATTTTTGAAGG - Intergenic
959789329 3:110338487-110338509 CTGCAGGAATAGGTATTTGCTGG + Intergenic
960393318 3:117105902-117105924 GTGGAGGCATATGTTTAGGAAGG - Intronic
960514981 3:118593573-118593595 CTCAAGTCATAGGTATTTGAGGG + Intergenic
961495196 3:127286515-127286537 CTGGAGGTATTGGAATTTGATGG - Intergenic
963389504 3:144641052-144641074 ATGGAGGCATAGATTTTTAGAGG + Intergenic
963609752 3:147452412-147452434 CTGGAGACACAGGTGGTTGAGGG + Intronic
963787468 3:149549368-149549390 CTGGAGTTATAGGTTTTTGGAGG - Intronic
964491518 3:157241485-157241507 CTGGCAGCATAGCCTTTTGAGGG - Intergenic
965017081 3:163171769-163171791 CTGGATTCATTGATTTTTGAAGG + Intergenic
965870655 3:173260710-173260732 TTGGAGGTTTGGGTTTTTGAAGG + Intergenic
969071863 4:4546178-4546200 GTGAAGGTATATGTTTTTGAAGG - Intergenic
969687881 4:8686374-8686396 ATGGAGGCACAGGGTTGTGAAGG + Intergenic
970991116 4:22214580-22214602 CTGGATTCATTGATTTTTGAAGG - Intergenic
971053661 4:22889112-22889134 CTGGATTCATTGATTTTTGAAGG + Intergenic
973909566 4:55565731-55565753 TTGGAGGCTGAGGTTTTTCAAGG - Intronic
974162051 4:58152706-58152728 CTGGATTCATTGATTTTTGAAGG - Intergenic
974216177 4:58850423-58850445 CTGGATTCATTGATTTTTGAAGG + Intergenic
974280572 4:59786363-59786385 CTGAAAGCATAGGTTTTAAAGGG - Intergenic
974600490 4:64073507-64073529 CTGGATTCATTGATTTTTGAAGG + Intergenic
974707054 4:65532814-65532836 CTATAGGCATAGTTTTTTAATGG + Intronic
975227809 4:71894652-71894674 CTGGATTCATTGATTTTTGAAGG - Intergenic
976532053 4:86166913-86166935 CTGGATTCATTGATTTTTGAAGG - Intronic
976636654 4:87293086-87293108 GTAGAGGCATGGGTTTTTTAAGG + Intergenic
976783415 4:88787985-88788007 CTGTAGGCACAGATTTTTTAAGG - Intronic
977154780 4:93558273-93558295 CTGGATTCATTGATTTTTGAAGG - Intronic
977332867 4:95660064-95660086 CAGGAGGGAAAGATTTTTGAAGG - Intergenic
977986121 4:103385414-103385436 CTGGTGGCATAGGCATTGGAGGG - Intergenic
978313231 4:107409309-107409331 CTGGAGGCATAGGCACTGGAGGG - Intergenic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
978773043 4:112477538-112477560 CTGGATCCATTGATTTTTGAAGG + Intergenic
979048535 4:115900680-115900702 CTGGATTCATTGATTTTTGAAGG - Intergenic
979423349 4:120533338-120533360 CTGGATTCACTGGTTTTTGAAGG + Intergenic
980245654 4:130236904-130236926 CTGAAGGCAAATGTTTTTTATGG + Intergenic
980732919 4:136845869-136845891 CTGGATTCATTGATTTTTGAAGG + Intergenic
981527033 4:145716737-145716759 ATGGAGATAAAGGTTTTTGATGG + Intronic
981560671 4:146045219-146045241 CTGGATTCATTGATTTTTGAAGG + Intergenic
982173225 4:152681665-152681687 CTGGAGGCAAATGTTTGTCAAGG + Intergenic
982848108 4:160276570-160276592 CTGGTGGTATAGGCTTATGAGGG - Intergenic
984318152 4:178156324-178156346 CTGCAGAAATAGATTTTTGATGG + Intergenic
986039021 5:3968974-3968996 CTGCAGCCTCAGGTTTTTGATGG - Intergenic
986048795 5:4067409-4067431 ATGGAAACATAGGATTTTGAGGG + Intergenic
986957426 5:13170578-13170600 CTTGAGGCCTAGGTATTTGCTGG - Intergenic
988927083 5:36000575-36000597 CTGGAGGTAAAGGTCTTTGTTGG - Intergenic
989820421 5:45789313-45789335 CTGGATTCATTGATTTTTGAAGG - Intergenic
990183818 5:53191455-53191477 CTGGTGGCATAGGCTCCTGAGGG + Intergenic
990705017 5:58518302-58518324 CTGGATTCATTGATTTTTGAAGG - Intergenic
991224537 5:64254836-64254858 CTGGATTCACAGGTTTATGAGGG + Intronic
992362674 5:76056949-76056971 CTGGATTCATTGATTTTTGAAGG + Intergenic
992631449 5:78685124-78685146 CTGGATTCATTGATTTTTGAAGG - Intronic
993777974 5:92025765-92025787 CTGGAGGCAGAGATTGTTGTGGG + Intergenic
994572049 5:101527707-101527729 CTGGATTCATTGATTTTTGAAGG + Intergenic
994991015 5:106997220-106997242 CTGGATTCATTGATTTTTGAAGG + Intergenic
995310023 5:110699845-110699867 CTGGAGATATAGGTTATTGAAGG - Intronic
996275665 5:121663095-121663117 CTGGATTCATTGATTTTTGAAGG - Intergenic
996279118 5:121706040-121706062 ATGGAGGGATAGGGTTTTGTGGG + Intergenic
997070829 5:130620213-130620235 CTGGATTCATTGATTTTTGATGG - Intergenic
1000910904 5:167020637-167020659 TTGGAGGTATAGGTTTTTATTGG + Intergenic
1003474167 6:6466169-6466191 CTGGAAGAGGAGGTTTTTGAGGG - Intergenic
1003503407 6:6721102-6721124 CTGGAGGCAGATGGTGTTGATGG + Intergenic
1005785554 6:29241934-29241956 CTGGATTCATTGATTTTTGAAGG + Intergenic
1007873262 6:45065496-45065518 CTGGATTCATTGATTTTTGAAGG - Intronic
1008095027 6:47331025-47331047 CTGGATTCATGGATTTTTGACGG - Intergenic
1008294435 6:49757953-49757975 CTGGTGGAATAGGTTCATGAAGG + Intergenic
1008414831 6:51227526-51227548 CTGGATTCATTGATTTTTGAAGG - Intergenic
1008700342 6:54091745-54091767 CTGGAGGCCTAGGGTTTAGAAGG - Intronic
1010004156 6:70977335-70977357 CTGGATTCATTGATTTTTGAAGG - Intergenic
1010313172 6:74412300-74412322 CTGTAGGCATAGGCTTGTGCAGG - Intergenic
1010628280 6:78166191-78166213 GTGGTGGCAGAGGTTTTAGAGGG - Intergenic
1011234890 6:85205174-85205196 CTGGATTCATTGATTTTTGAAGG - Intergenic
1012778301 6:103525074-103525096 CTGGATTCATTGATTTTTGAAGG - Intergenic
1013947856 6:115744170-115744192 CTGGATTCATTGTTTTTTGAAGG - Intergenic
1014347756 6:120295507-120295529 CTGGATTCATTGATTTTTGAAGG + Intergenic
1015109211 6:129572154-129572176 CTGGATTCATTGATTTTTGAAGG - Intergenic
1015247345 6:131089508-131089530 CTGGATTCATTAGTTTTTGAAGG - Intergenic
1015570616 6:134617797-134617819 GTGGAGGCAGAGATTTTCGACGG + Intergenic
1015898089 6:138036243-138036265 CTGGAGGCCTAGGAGTATGACGG - Intergenic
1015985078 6:138876371-138876393 CTGAAGGCAGAGGCTTCTGAGGG + Intronic
1018138205 6:160799194-160799216 CTCAAGTCATAGGTATTTGAGGG + Intergenic
1019099083 6:169612797-169612819 CTGGTGGCATAAGATTATGATGG - Intronic
1020773870 7:12429286-12429308 CTGGATTCATTGATTTTTGAAGG + Intergenic
1020848541 7:13319417-13319439 CTTCAGGCATGGGTTTGTGAGGG + Intergenic
1021508480 7:21410447-21410469 CTGTGGGCATAGGTTGCTGATGG + Intergenic
1028385713 7:90250809-90250831 CTGGAGGAAGAGGTTTGTGTTGG - Intronic
1028895295 7:96034236-96034258 CTGGAGGGATTGGTATTTTATGG + Intronic
1029017896 7:97333237-97333259 CTGGAATCATTGATTTTTGAAGG - Intergenic
1030840723 7:114350654-114350676 AAGAAGGCAAAGGTTTTTGAAGG + Intronic
1032595152 7:133232560-133232582 CTGCAGGCAGAGGGTTCTGAGGG - Intergenic
1032603409 7:133324166-133324188 CTGGATTCATTGATTTTTGAAGG + Intronic
1032686771 7:134242239-134242261 CTGGATTCATTGATTTTTGAAGG - Intronic
1033812176 7:145028517-145028539 CTGGAGCTATGGATTTTTGAGGG - Intergenic
1034282748 7:149865192-149865214 CTGCAGCCAGAGGTCTTTGAGGG - Exonic
1034314791 7:150120270-150120292 CTGGATTCATTGATTTTTGAAGG - Intergenic
1034447452 7:151120901-151120923 CTGGAGGATTAGGGTTTGGATGG - Intronic
1034792110 7:153980502-153980524 CTGGATTCATTGATTTTTGAAGG + Intronic
1035237794 7:157510117-157510139 CTGGATTCATTGATTTTTGAAGG - Intergenic
1037557372 8:20038260-20038282 CTGGATTCATTGATTTTTGAAGG + Intergenic
1037667156 8:20979894-20979916 CAGAAGGCATAGCTTTTTGCAGG - Intergenic
1039285105 8:36031237-36031259 CTGGATTCATTGATTTTTGAAGG - Intergenic
1039287934 8:36062729-36062751 TTGGAGGCTGAGGTTTTTCAAGG - Intergenic
1040368280 8:46742840-46742862 CTGGATTCATTGATTTTTGAAGG + Intergenic
1043724254 8:83589683-83589705 CTGGAGTTATAGGTTTTAGGAGG - Intergenic
1043786362 8:84405395-84405417 CTGGATTCATTGATTTTTGAAGG - Intronic
1043850077 8:85205895-85205917 ATGGAGGCAAAGGTTTCTGGGGG - Intronic
1044402695 8:91790951-91790973 CTAGATTCATTGGTTTTTGAAGG - Intergenic
1044798667 8:95930841-95930863 CTGGATTCATTGATTTTTGAAGG + Intergenic
1045389046 8:101696985-101697007 CTGGATTCATTGATTTTTGAAGG - Intronic
1046045571 8:108960365-108960387 CTGGAGACATATGTCTTTGGAGG + Intergenic
1046090845 8:109501207-109501229 CTGGTGGAATAGATTCTTGAAGG - Intronic
1048876430 8:138839991-138840013 TTGGAGGCATAGGTCTTAGATGG - Intronic
1049872000 8:144987197-144987219 CTGGATTCATTGATTTTTGAAGG + Intergenic
1050787972 9:9429089-9429111 CTGGATTCATTGATTTTTGAAGG - Intronic
1050973625 9:11909401-11909423 CTGGATTCATTGATTTTTGAAGG + Intergenic
1051319579 9:15887423-15887445 AAGGAGGCATAAGTTTTTGAGGG + Intronic
1051720014 9:20027634-20027656 TTAGAGGCTGAGGTTTTTGAAGG + Intergenic
1051836465 9:21343782-21343804 CTAGAGTCATTGGTTTTTGAAGG - Intergenic
1051848273 9:21477531-21477553 ATGAAGGCATAGTTTTTTTAAGG - Intergenic
1052061592 9:23966772-23966794 CTGGTGGCATAGGCATCTGAGGG + Intergenic
1053050878 9:34959252-34959274 CTGGAGGGAAAGGCCTTTGAAGG + Intronic
1053075757 9:35132975-35132997 CTGAACTCATAGGTATTTGATGG + Intergenic
1053521294 9:38782537-38782559 CTGGATTCATTGATTTTTGAAGG - Intergenic
1054193457 9:62006530-62006552 CTGGATTCATTGATTTTTGAAGG - Intergenic
1054644951 9:67582161-67582183 CTGGATTCATTGATTTTTGAAGG + Intergenic
1055234336 9:74101926-74101948 CTGGTGGCATGGGCTTATGAGGG - Intergenic
1056256885 9:84808627-84808649 CTGGAGGCAAAACTTTTAGAAGG + Intronic
1058393130 9:104520181-104520203 CTGGTGGCACAGGTATTGGAGGG - Intergenic
1059399736 9:114061367-114061389 CTGGAGGGACAGGGTCTTGAGGG + Intronic
1059966924 9:119624283-119624305 CTGGATTCATTGATTTTTGAAGG + Intergenic
1186240987 X:7566123-7566145 CTGGGTTTATAGGTTTTTGAGGG + Intergenic
1186755402 X:12665529-12665551 CTGGATTCATTGGTTTGTGAAGG + Intronic
1186964146 X:14769612-14769634 CTGGATTCATTGATTTTTGAAGG + Intergenic
1187075668 X:15931993-15932015 CTGGAATCATATGGTTTTGAAGG - Intergenic
1189338103 X:40183108-40183130 CTGGAGCCACATGTTTCTGAAGG - Intergenic
1189941849 X:46132345-46132367 TTGGAGGCAAAGATTTTTGCAGG + Intergenic
1190621849 X:52294958-52294980 CTGGATTCATTGATTTTTGAAGG - Intergenic
1191028304 X:55939562-55939584 CTGGATTCATTGATTTTTGAAGG - Intergenic
1191064998 X:56338601-56338623 CTGGATTCATTGATTTTTGAAGG + Intergenic
1191066668 X:56355575-56355597 CTGGATTCATTGATTTTTGAAGG + Intergenic
1191124209 X:56937115-56937137 CTGGATTCATTGATTTTTGAAGG + Intergenic
1191705071 X:64085704-64085726 CTGGTGGCATAGGTACTGGAGGG - Intergenic
1191809250 X:65168989-65169011 CTGGAGTCATTGATTTTTAAAGG + Intergenic
1191829112 X:65396137-65396159 CTGGATTCATGGATTTTTGAAGG + Intronic
1193001826 X:76571212-76571234 CTGGATTCATGGATTTTTGAAGG - Intergenic
1193010800 X:76672818-76672840 CTGGATTCATTGATTTTTGAAGG - Intergenic
1193477517 X:81984782-81984804 CTGGATGCATTGATTTTTGAAGG - Intergenic
1193581703 X:83272735-83272757 CTTGAGGAAAAGGTTTTTCATGG + Intergenic
1193640863 X:84008369-84008391 CTGGAGGCAAAGGTCTTTGGTGG - Intergenic
1193822586 X:86184130-86184152 CTGGATTCATTGATTTTTGAAGG + Intronic
1194069744 X:89306635-89306657 ATGGAGGAACAGATTTTTGAAGG + Intergenic
1194185335 X:90768214-90768236 CTGGATTCATTGATTTTTGAGGG - Intergenic
1194558688 X:95394140-95394162 CTGGAGCCCTAGGGTTTTGATGG + Intergenic
1194608497 X:96011188-96011210 CTGGATTCATTGATTTTTGAAGG - Intergenic
1194772666 X:97924232-97924254 CTGGATTCATTGATTTTTGAAGG - Intergenic
1196414627 X:115457811-115457833 CTGGAAACATTGGTTTTTGCTGG - Intergenic
1196901479 X:120388021-120388043 CTGGATTCATTGATTTTTGAAGG + Intergenic
1197806505 X:130403181-130403203 GTGGAAGCAGAGGTTTGTGATGG + Intronic
1198645201 X:138799015-138799037 CTGGATTCATTGATTTTTGAAGG + Intronic
1199939335 X:152609512-152609534 CTGGATTCATTGATTTTTGAAGG + Intergenic
1200516449 Y:4149427-4149449 CTGGACTCATGGGTTTTTAAGGG - Intergenic
1200531960 Y:4350300-4350322 CTGGATTCATTGATTTTTGAAGG - Intergenic
1200723891 Y:6640776-6640798 ATGGAGGAACAGATTTTTGAAGG + Intergenic
1200871100 Y:8099416-8099438 CTGGATTCATTGATTTTTGAAGG + Intergenic
1201263561 Y:12184014-12184036 CTGGATTCATTGATTTTTGAAGG - Intergenic
1201313091 Y:12615193-12615215 CTGGATTCATTGATTTTTGAAGG - Intergenic
1201741476 Y:17328397-17328419 CTGGAGGCATTGAGTTTTTAAGG + Intergenic
1202341886 Y:23878271-23878293 CTGGATTCATGGATTTTTGAAGG + Intergenic
1202528881 Y:25791815-25791837 CTGGATTCATGGATTTTTGAAGG - Intergenic