ID: 926938619

View in Genome Browser
Species Human (GRCh38)
Location 2:18112741-18112763
Sequence TCCTACTACCTCCTTCACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926938618_926938619 19 Left 926938618 2:18112699-18112721 CCAGACAGCACAAAGTGTTGGTC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 926938619 2:18112741-18112763 TCCTACTACCTCCTTCACCATGG 0: 1
1: 0
2: 1
3: 14
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926938619 Original CRISPR TCCTACTACCTCCTTCACCA TGG Intronic
900016300 1:152626-152648 TCCTATTACCTCTGTCACGAAGG - Intergenic
900046564 1:511217-511239 TCCTATTACCTCTGTCACGAAGG - Intergenic
900068768 1:752935-752957 TCCTATTACCTCTGTCACGAAGG - Intergenic
900561979 1:3311747-3311769 TCCATCTGCCTCCTTCCCCAAGG + Intronic
901172108 1:7266702-7266724 TCCTGCCTCCTCCGTCACCAAGG - Intronic
901536143 1:9883985-9884007 TCCTCCTTCCTCCTTCCCCATGG - Intronic
902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG + Intronic
903761993 1:25704877-25704899 TCCTCCTGCATCCTTCTCCATGG - Intronic
904132163 1:28283016-28283038 TCCTACCGCCTCCAGCACCAAGG + Intergenic
907934269 1:59028198-59028220 TTCTACTCCCTCCTCCCCCATGG - Intergenic
908982356 1:69973976-69973998 TTCCAATCCCTCCTTCACCAAGG + Intronic
913036861 1:114976132-114976154 TCCTACTATCTTGTGCACCAAGG - Intronic
915117151 1:153608286-153608308 TCCTGCCACCTTCTTCTCCAGGG - Intronic
915758967 1:158291780-158291802 TCCTCCTACCTCCCTCACAAAGG + Intronic
915870320 1:159552525-159552547 TCTTACTTTCTCCTTGACCATGG + Intergenic
917191034 1:172419375-172419397 TCCAAATACCTCCTTTGCCAGGG - Intronic
917587569 1:176443355-176443377 CTCTACTACCTCCTACACTAAGG - Intergenic
918195069 1:182213546-182213568 TCCTACTTCTTCATCCACCAAGG - Intergenic
920406740 1:205720170-205720192 GTCTACAACCTCCTCCACCAGGG + Intronic
920922598 1:210310751-210310773 TCCTACTACCTGCCACACCCTGG - Intergenic
921759191 1:218892484-218892506 TGCTACTGCCACCATCACCAAGG - Intergenic
922264443 1:223970846-223970868 TCCTATTACCTCTGTCACGAAGG - Intergenic
923659218 1:235944107-235944129 TCCTGTTAGCTCCTTCCCCATGG - Intergenic
924294879 1:242576606-242576628 TCCTACCACCACTTTCTCCAGGG - Intergenic
1063083773 10:2794002-2794024 TCGAATTTCCTCCTTCACCAAGG - Intergenic
1064940175 10:20725479-20725501 CTCTAGTACCTCCTTCACCAAGG + Intergenic
1066730050 10:38429001-38429023 TCCTATTACCTCTGTCACGAAGG + Intergenic
1068117354 10:52749731-52749753 TTCCACTACCTCCTTCAAGAAGG + Intergenic
1070776054 10:79110538-79110560 ACCAACTACCTCCTTCCCCAGGG - Intronic
1070807925 10:79281511-79281533 CCCTGCTGCCTCCATCACCATGG + Intronic
1071544046 10:86514484-86514506 TCTTCCTTCCTCCTTCACAAAGG - Intronic
1073549620 10:104385741-104385763 TCCCACTACATCCTTGACCAGGG - Intronic
1073798969 10:107020388-107020410 TCCCTCTTCCTCCTTCCCCAAGG - Intronic
1074696939 10:116058354-116058376 TCCTATTCCCACCTGCACCATGG + Intronic
1075469861 10:122680023-122680045 GGCTACTTCTTCCTTCACCATGG + Intergenic
1076103069 10:127797941-127797963 TCCTACTGCCTCCTTTTGCAAGG + Intergenic
1076467816 10:130697141-130697163 TCCTACCACTTTCTTCACAATGG - Intergenic
1076972892 11:147695-147717 TCCTATTACCTCTGTCACGAAGG - Intergenic
1078275975 11:9847033-9847055 TCCCATTGCCTCCATCACCAAGG - Exonic
1080309285 11:30870462-30870484 TCCTACTACCTCACTCTCAAAGG - Intronic
1084769604 11:71334230-71334252 TCCTCCTCCCTCCTTCTCCTGGG - Intergenic
1084857497 11:71998297-71998319 TCCCCCTACCTCCTGCCCCAGGG - Intergenic
1084979093 11:72819508-72819530 TCTTACTACCTCTGTCCCCATGG + Intronic
1085087036 11:73675408-73675430 TCCTATTACTGCCTCCACCAGGG + Intergenic
1085362526 11:75903413-75903435 TCCCACTACTTCCCTCTCCAGGG + Intronic
1086944596 11:92832428-92832450 TCCTCCTACCTCCTTCACAGAGG + Intronic
1089369644 11:117946333-117946355 TCCTACTACCTCCTTGCAGATGG + Intergenic
1089760222 11:120717661-120717683 TCCTGCTTCCTGCATCACCAAGG + Intronic
1090522027 11:127489665-127489687 TCCTTCTACCTGCCTCCCCATGG + Intergenic
1094441721 12:30485466-30485488 TCCTCCTGCCTCCACCACCAAGG + Intergenic
1096007806 12:48186106-48186128 ACTTACCACCTCCTTCCCCAGGG - Intergenic
1102937957 12:116913121-116913143 ACCTGCTAACTCCATCACCAGGG + Intronic
1107312105 13:39090265-39090287 ACCTACTACTTCCTTCTCCCAGG - Intergenic
1111854921 13:93625663-93625685 TCCTTCTACCTCTTTTCCCAAGG + Intronic
1112794816 13:103045228-103045250 TCCTGCCACCTCCCTGACCATGG + Exonic
1113222050 13:108116096-108116118 TCCGACTAACTCCTTCAGCTGGG - Intergenic
1116481928 14:45401510-45401532 GCCTACTGACTCCTTAACCAAGG - Intergenic
1116880434 14:50162181-50162203 TCTTACTCACTCCGTCACCAAGG + Intronic
1120636306 14:86955562-86955584 TCATGTTACCTCTTTCACCATGG + Intergenic
1122087313 14:99316850-99316872 TCCTACCCCCTCCACCACCAAGG - Intergenic
1122175653 14:99916745-99916767 TATTACTGCCCCCTTCACCATGG + Intronic
1122533447 14:102445322-102445344 CTCTACTCCCTCCCTCACCAAGG - Intronic
1122859007 14:104573921-104573943 AGCTACTACCTCCTGCCCCAGGG - Intronic
1123911672 15:24974177-24974199 TCATACTAGCTTCCTCACCAAGG - Intronic
1124140388 15:27072309-27072331 GCATCCTACCTCCTTCTCCATGG + Intronic
1128083532 15:64870768-64870790 TCTTACCACATCCTTCCCCATGG - Intronic
1129221168 15:74132482-74132504 TCCTACTCCTTCCTTCACGCTGG - Intronic
1129560396 15:76560222-76560244 CCCTTCAACCTCCTTCACAAGGG - Intronic
1130090529 15:80817090-80817112 AGCTCCTTCCTCCTTCACCATGG - Intronic
1130897892 15:88184786-88184808 TCCTACTTCCAGCATCACCAGGG + Intronic
1131998551 15:98157074-98157096 TCCTACTCCTCCCTTCACCCAGG - Intergenic
1132716328 16:1291933-1291955 TCTTGCTTCCTCCTTCACCGTGG + Intergenic
1133008381 16:2897010-2897032 GCCTACTGGCTCCTTCACAAGGG + Intronic
1135798110 16:25465575-25465597 TCCTACCACCTCCTTCCACCAGG + Intergenic
1136664646 16:31799218-31799240 CCCTTCAACCTCCTTCACAAGGG + Intergenic
1137295859 16:47092749-47092771 TGCTGCTGCTTCCTTCACCAGGG - Intronic
1141351776 16:83304786-83304808 TCTTACTAGCAGCTTCACCAAGG - Intronic
1141522455 16:84590105-84590127 CTGTACGACCTCCTTCACCAGGG + Exonic
1142447359 16:90149832-90149854 TCCTATTACCTCTGTCACGAAGG + Intergenic
1142460135 17:85500-85522 TCCTATTACCTCTGTCACGAAGG - Intergenic
1144262353 17:13534618-13534640 TCCTACCACCTCATTCTCCCAGG - Intronic
1145242250 17:21246868-21246890 TCCTTCAACCTCCTACCCCAGGG - Intronic
1145894413 17:28445520-28445542 TCCTAACACCTCCTGAACCAAGG + Intergenic
1147358986 17:39919458-39919480 TCCACCTACCTCCTTCTCCAGGG + Intronic
1147381655 17:40059957-40059979 TCCTGCTACCTCCTTAGCAACGG + Intronic
1147424876 17:40341756-40341778 CCCCACCACCTCCTCCACCACGG + Intronic
1147428547 17:40357524-40357546 TGCCCCGACCTCCTTCACCAGGG + Intronic
1147749740 17:42722786-42722808 TACCACTACCTTCTTCACCATGG + Exonic
1148205143 17:45775289-45775311 GCCACCTACTTCCTTCACCATGG + Intergenic
1149998289 17:61416421-61416443 GCCCACTAGCTCCTTCTCCAGGG + Intergenic
1152101509 17:78304488-78304510 TCCTCCTATCTCCTTCCCTAGGG + Intergenic
1152997754 18:424211-424233 TCCCCCAACCTCCATCACCATGG + Intronic
1153234329 18:2971249-2971271 TCCCACTTCCTCCTTACCCAGGG - Intronic
1154239679 18:12641442-12641464 TACTACAACCTCCGTCTCCAGGG + Intronic
1154301146 18:13193600-13193622 TCCTCCTACCCCATTCAACAGGG - Intergenic
1158282233 18:55840643-55840665 ACCTAGTGCCTCCTGCACCAGGG + Intergenic
1158503188 18:58022049-58022071 ACCTATTACCTCCCTCCCCATGG - Intergenic
1159755393 18:72358060-72358082 ACCAACTGCCTCCTTCACCCTGG + Intergenic
1159890015 18:73944132-73944154 TCCTCCCACCTCCTTCCCCACGG + Intergenic
1160054952 18:75470457-75470479 TCTTATGACCTCCTTCACCCAGG + Intergenic
1160649849 19:218000-218022 TCCTATTACCTCTGTCACGAAGG - Intergenic
1160793437 19:933314-933336 CCCTACTTCCTCCTTCAGCCTGG - Intronic
1163061790 19:14766657-14766679 TCCTGCTCCCTCCCTCACTATGG + Intronic
1163620688 19:18358023-18358045 TCCTGCTACCACCTTGACCTTGG - Intronic
1163738360 19:18995564-18995586 TCCTACTGACTCCTTGACCCCGG - Intronic
1165502528 19:36201548-36201570 TCCTACAACCTCCATCTCCTGGG + Intronic
1165998593 19:39863603-39863625 CCATACTACATCCCTCACCATGG + Exonic
1168491637 19:56815780-56815802 TCTTACTGCCCCCTTCACAAGGG + Exonic
925097461 2:1218709-1218731 TCATACCACCTGCTTCCCCAGGG - Intronic
926192791 2:10741355-10741377 CTCTACTTCCTCCTCCACCAAGG - Intronic
926934446 2:18073060-18073082 TCCTCCTGCCTCCTTGACCAAGG - Intronic
926938619 2:18112741-18112763 TCCTACTACCTCCTTCACCATGG + Intronic
927065345 2:19465304-19465326 ATCTTCTACCTCCATCACCAAGG - Intergenic
927947968 2:27148847-27148869 TCCTCCTGCCTTCTTCAGCATGG + Intergenic
929234711 2:39593682-39593704 TCTTCCCACCTCCTTCCCCATGG - Intergenic
932747609 2:74347082-74347104 TCCTACACCCTCCTTCCCAAAGG + Intronic
932780482 2:74555754-74555776 TCCTACTTCTTACTTCCCCATGG - Intronic
933991620 2:87638047-87638069 TCTTCCTCCCTCCCTCACCAGGG - Intergenic
935484997 2:103642281-103642303 TCTTACTTCCTCTTCCACCAGGG + Intergenic
936110714 2:109662203-109662225 TCCTTTTCTCTCCTTCACCAAGG + Intergenic
936302223 2:111312775-111312797 TCTTCCTCCCTCCCTCACCAGGG + Intergenic
937333170 2:121044651-121044673 TCCCAGTGCCTCCTTCACCGGGG - Intergenic
938904929 2:135828366-135828388 TCCCACCATCTCCGTCACCAAGG - Intronic
940297284 2:152140706-152140728 TGCTTTTACCTCCTTCAGCAGGG + Intronic
942321757 2:174742151-174742173 TCCCTCTGCCTCCTTCCCCAGGG + Intergenic
942375106 2:175328614-175328636 TCCTACTTCCTGTTTCTCCAAGG - Intergenic
944217178 2:197268106-197268128 GCCAACTACCTCCTTCACCATGG + Intronic
946201781 2:218074824-218074846 TCCTTCTCCCTCCTGCACCTGGG - Intronic
948954798 2:241279968-241279990 TCCTCCTAACCCCTTCAGCATGG - Intronic
1169197393 20:3690723-3690745 TCCCACTCCAGCCTTCACCAAGG - Intronic
1169682049 20:8226557-8226579 ACCTCCTACTTCCTTCTCCATGG + Intronic
1170807427 20:19644769-19644791 TCCTCCTGCCCCCTTCTCCAGGG + Intronic
1172696140 20:36824351-36824373 TCCTGCTACATTCTTCAACATGG + Intronic
1173768151 20:45632381-45632403 TCCTAAGACCTCCTTGTCCAAGG - Intergenic
1174982239 20:55408856-55408878 TCCTCCTAGCCCCATCACCATGG - Intergenic
1175411024 20:58769119-58769141 TTGTGCTACCTCCTTTACCAAGG - Intergenic
1176255109 20:64147656-64147678 ACCCACTATCTCCTTCCCCAGGG - Intergenic
1181815557 22:25434107-25434129 TCCCCCTTCCTCCCTCACCATGG + Intergenic
1182835045 22:33334952-33334974 TCCTACCATCTCCTTCCCCTGGG - Intronic
1183520851 22:38295317-38295339 TCTCACTTCCTCCTGCACCAGGG - Intronic
949240423 3:1864890-1864912 TCCTTCTACCTCCTCTAGCATGG - Intergenic
952280689 3:31920400-31920422 TTCTCCTACCTCCTTCAGTAAGG - Intronic
953038994 3:39238096-39238118 TCCTACTATCACCCACACCAGGG - Intergenic
954098713 3:48352940-48352962 TCCTTCTACCTCCTTTCCCTGGG - Intergenic
955809496 3:62771781-62771803 TCCGTCTACCTCATTAACCAAGG + Intronic
956677347 3:71748462-71748484 TCCTCCTACCTTCATCTCCAGGG - Intronic
956876325 3:73467301-73467323 TCCTGCTGCTTCCTTCACCTGGG - Intronic
959976809 3:112470144-112470166 TCCTACTACCTAGTTCACTTTGG + Intronic
961139832 3:124546600-124546622 TCAGAATGCCTCCTTCACCATGG + Intronic
965071795 3:163924295-163924317 TCCTACTTCCTTCTACAGCAGGG - Intergenic
968312111 3:197692431-197692453 TCCCACGACCCCCTTCCCCAAGG - Intronic
968367999 3:198202129-198202151 TCCTATTACCTCTGTCACGAAGG + Intergenic
969290433 4:6235615-6235637 ACCTACTACCTCTTTTACCTTGG + Intergenic
974332488 4:60498534-60498556 TCCTTCTGCCTTCTTCCCCATGG - Intergenic
974753935 4:66179257-66179279 TCCTCCTTCCTCCTTGAACAGGG - Intergenic
976089071 4:81436359-81436381 TCATATTTCCTCCTTCACCTGGG - Intronic
976765570 4:88593882-88593904 TGCTACTCCCTCCTCCCCCAGGG - Intronic
978561870 4:110042361-110042383 ACCTATTACCTTCTTCCCCATGG - Intergenic
979256425 4:118611844-118611866 TCCTATTACCTCTGTCACGAAGG + Intergenic
979331925 4:119428693-119428715 TCCTATTACCTCTGTCACGAAGG - Intergenic
986014902 5:3749092-3749114 CCCTGGTGCCTCCTTCACCAGGG + Intergenic
991914767 5:71594671-71594693 TCTCCCTACCTCCTTCCCCAGGG - Intronic
993026731 5:82655378-82655400 TCCTGCTTCCCCCTTCACCAGGG + Intergenic
993281701 5:85933421-85933443 CCCTTCTACCTCTTTCACAAGGG - Intergenic
993584461 5:89706897-89706919 TCCTAATACCTACCTCACAAAGG - Intergenic
996554865 5:124768046-124768068 CCCTACTACCTTCATCAACATGG - Intergenic
996856785 5:128017066-128017088 TGCTGCCACCTCCTCCACCAGGG - Intergenic
997390634 5:133512057-133512079 TCCTTCTACATCCTTCACTGAGG + Intronic
999598542 5:153234103-153234125 TCATCCCACCTCCTTCTCCAGGG + Intergenic
1000002588 5:157153084-157153106 TTCTCCTACCTCCTTCTCCTGGG + Intronic
1002727218 5:181307358-181307380 TCCTATTACCTCTGTCACGAAGG + Intergenic
1006020157 6:31112969-31112991 TCCTCATATCTCCTTCACCTTGG + Intergenic
1006437098 6:34031346-34031368 TCAGACAAGCTCCTTCACCATGG - Intronic
1008678851 6:53850766-53850788 TCTTACCACCTACTTCCCCAAGG - Intronic
1012203375 6:96434156-96434178 TCCTCCCACCACCTTCATCAAGG - Intergenic
1013429086 6:110040041-110040063 TTCTACTTTCTCCTTTACCAAGG - Intergenic
1015457350 6:133441748-133441770 TCCAATTACCTGCTTCACCCTGG - Intronic
1019310809 7:359767-359789 TCCTGGCACCTCCTGCACCAGGG + Intergenic
1022276477 7:28860186-28860208 TCCTGCGACCTCCTACACCATGG - Intergenic
1025612100 7:63083628-63083650 GCCTAGAACCTTCTTCACCAGGG + Intergenic
1025707423 7:63880379-63880401 GCCTAGAACCTTCTTCACCATGG - Intergenic
1025909773 7:65819017-65819039 TCCTATTACCTCTATCACTAAGG + Intergenic
1026443485 7:70463807-70463829 TCCTCCTTCCTCCCTCTCCATGG - Intronic
1028363643 7:89999790-89999812 TCTTGCTGCCTTCTTCACCAAGG + Intergenic
1028454081 7:91019336-91019358 TCCTACTGCATCCTTACCCAGGG + Intronic
1029331498 7:99860005-99860027 ACCTTCTCCCTCCTTCTCCAGGG - Intronic
1030535227 7:110757908-110757930 TCCTTCTACCACCTTCCCCTCGG - Intronic
1032048737 7:128632592-128632614 TCCTATTACCTCTGTCACGAAGG + Intergenic
1032271174 7:130408083-130408105 CCCTCCTGCCTCCTTCCCCAAGG + Intronic
1032511259 7:132474406-132474428 TCCTACTACCTCCTGCAGGCTGG - Intronic
1033289304 7:140069559-140069581 TCCAATCACCTCCTTCATCAGGG + Intergenic
1035296940 7:157872696-157872718 TCCTTCTACCTCCTGCAAGATGG - Intronic
1035787645 8:2274903-2274925 TCCTCCTCCCTCCTTCCCCTTGG + Intergenic
1035805165 8:2446813-2446835 TCCTCCTCCCTCCTTCCCCTTGG - Intergenic
1036048606 8:5170739-5170761 TCCTAGTGCCACCATCACCAAGG - Intergenic
1036543299 8:9740422-9740444 TCCTCCTACCGCCTTCTCCCTGG + Intronic
1037617176 8:20530101-20530123 TTCTACTGCTTCCTACACCAGGG - Intergenic
1039440935 8:37595003-37595025 GCCCACTCCCTCCTTCACCCGGG + Intergenic
1042982380 8:74544826-74544848 TCCTACTACTTTCTTGAACATGG - Intergenic
1045213651 8:100125096-100125118 TCTTTCTACCTCCTTTAGCATGG - Intronic
1045863002 8:106834290-106834312 TCCTACTACCTCCATCCAAATGG + Intergenic
1047726124 8:127685484-127685506 TCCTGGTCCCTCCTTTACCACGG + Intergenic
1049199015 8:141330912-141330934 ACCCACAACCTCCTGCACCAGGG - Intergenic
1049353799 8:142177916-142177938 TCCTCCTTCCTCCTCCAACAGGG - Intergenic
1050599091 9:7232877-7232899 TCCTACTCCATCCTTAACCCTGG - Intergenic
1051370630 9:16356005-16356027 CCCTGCTTCCTCCTTCACCATGG - Intergenic
1053009683 9:34625903-34625925 TCCTACTGACTCCTTCAGCTAGG - Intronic
1055854578 9:80670255-80670277 TCCTTCTTCCTCCTTGGCCAGGG + Intergenic
1055978087 9:81973826-81973848 TGCTACTACATCTTACACCAAGG + Intergenic
1056117955 9:83459835-83459857 TCCTACTGGCTCCTTGACCCTGG - Intronic
1056413764 9:86356576-86356598 TCCTCCTACCTCAGTCTCCAGGG - Intergenic
1056950072 9:91034722-91034744 TCCTTCTTCCTCACTCACCAAGG + Intergenic
1057311402 9:93945456-93945478 GCCAACTCCCTCCTTCCCCAGGG - Intergenic
1059057107 9:110995410-110995432 TCCTAATATCTACTTCAGCATGG + Intronic
1059366217 9:113788367-113788389 CCCAACTCCCTCCTTCCCCAGGG + Intergenic
1059511855 9:114855564-114855586 TCCTACCACCTTCATCACTAAGG + Intergenic
1060235144 9:121857364-121857386 TCCTCCTACCTCCTCACCCAGGG - Intronic
1062255516 9:135619018-135619040 CCCTTCCACCTCCTTCACCTTGG + Intergenic
1062710881 9:137974612-137974634 TCCTAAAATCTCCTCCACCAAGG - Intronic
1062752340 9:138264834-138264856 TCCTATTACCTCTGTCACGAAGG + Intergenic
1186737872 X:12485169-12485191 TTGTACTACTTCCTTCACAAAGG - Intronic
1187473764 X:19591543-19591565 TCCTCCAACATCCTTGACCAAGG + Intronic
1187785205 X:22876927-22876949 TCCTTCCACCTCCTTGTCCATGG - Intergenic
1194392379 X:93336015-93336037 TGCCTCTAGCTCCTTCACCAGGG + Intergenic
1195887991 X:109660915-109660937 TCCTCCTCCCTCCTTCCCCTGGG - Intronic
1196462479 X:115944805-115944827 TCCTACTACACCATCCACCATGG + Intergenic
1197754374 X:129983934-129983956 TCCCTCTCCCTCCTTCTCCAAGG - Intronic
1198162159 X:134018568-134018590 TCTTTCTTCCTCCTTCACCAGGG + Intergenic
1199920505 X:152397868-152397890 ACCTACTACATGCTTCACCTTGG - Intronic