ID: 926939529

View in Genome Browser
Species Human (GRCh38)
Location 2:18120131-18120153
Sequence AACTGAAGGCAGTTGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926939525_926939529 26 Left 926939525 2:18120082-18120104 CCAGGAGACACGGAGGCGATCAC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 926939529 2:18120131-18120153 AACTGAAGGCAGTTGGAAGCTGG 0: 1
1: 0
2: 2
3: 28
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926939529 Original CRISPR AACTGAAGGCAGTTGGAAGC TGG Intronic
900928791 1:5722822-5722844 AAGTGAAGGAAGATGCAAGCTGG - Intergenic
901476209 1:9491276-9491298 ATCTGGAGGCAGCTGGCAGCTGG + Intergenic
904883317 1:33716976-33716998 AACAGAAAGCAGTTGACAGCAGG + Intronic
905112143 1:35603497-35603519 TACTGGAGGCAGTTGGCAGTAGG + Intronic
909266152 1:73560038-73560060 AATTGAGGACAGTAGGAAGCTGG - Intergenic
909664561 1:78118809-78118831 AACTGAAGGCAGTAAGAAATGGG - Intronic
910506875 1:87959413-87959435 AACTGAAGGGAGGAGGGAGCAGG + Intergenic
910605613 1:89080453-89080475 ATCACAAGGCAGTTGGAGGCAGG - Intergenic
912231365 1:107796330-107796352 CACTGATAGGAGTTGGAAGCCGG - Intronic
912485090 1:110020743-110020765 AAATGATGGCAGATGCAAGCTGG - Exonic
913230812 1:116739571-116739593 AACAGAAGGCATTTGGGAACAGG + Intergenic
917652993 1:177097284-177097306 AAGTGAAGGCATTTGGCAGTTGG - Intronic
918248161 1:182678988-182679010 ATCTGAGGGCAGCTGGAAGGAGG - Intronic
919725481 1:200880083-200880105 AACTGGTGGAAGTTGGAAGGTGG - Intergenic
921936078 1:220798494-220798516 ATCTGAGGGCAGATGGAAGGTGG - Intronic
922912328 1:229228203-229228225 AACAAAAGGCAGGTGGAAGAGGG + Intergenic
923492180 1:234493750-234493772 ACCCCAAGGCAGTTGGGAGCAGG + Intergenic
1062823461 10:551470-551492 AAGGGAAAGCAGCTGGAAGCAGG + Intronic
1064081465 10:12311333-12311355 CACTGCAGGCAGCTGGAGGCAGG - Intergenic
1065902059 10:30217125-30217147 ACCTGAAGGCAGTTAGGAGGAGG - Intergenic
1068862532 10:61861835-61861857 AGCTGAAGTCAGTTGGAATTAGG + Intergenic
1073783400 10:106863785-106863807 ATCTGAAGGCAATGGGAATCTGG - Intronic
1073839637 10:107483577-107483599 AATTGAAGACAGGTGGCAGCTGG + Intergenic
1075603241 10:123786396-123786418 CAGGGAAGGCAGCTGGAAGCAGG - Intronic
1077715592 11:4576965-4576987 AACTTAAGACAGTTGATAGCAGG - Intronic
1078908158 11:15706531-15706553 AAGTGATGGTATTTGGAAGCAGG + Intergenic
1080459452 11:32440226-32440248 AACTGAGGGCAGTTGGGAGAGGG - Intergenic
1080819581 11:35792638-35792660 CACTGAAGACATTTGGCAGCTGG - Intronic
1083778080 11:64903813-64903835 GACAGCAGGCAGTGGGAAGCGGG + Intronic
1084436728 11:69146891-69146913 AACTGAAGGCAATAGAAACCAGG - Intergenic
1085437752 11:76524090-76524112 TTCTGAAGGCAGTTGGTAGGAGG + Intronic
1085643082 11:78205664-78205686 AACTGAAGGGGTTTGGAAGCAGG + Intronic
1086528503 11:87756855-87756877 AATTGAAGGAAGAAGGAAGCAGG - Intergenic
1086544813 11:87955351-87955373 CACTGGAGGCTGCTGGAAGCGGG + Intergenic
1087224949 11:95588583-95588605 AACTCTGGGCATTTGGAAGCAGG - Intergenic
1090555862 11:127874718-127874740 ATCTGATGGCAGTTGGTAGAAGG - Intergenic
1091337757 11:134785340-134785362 AACTGAAGGCTGCTGGCAGGAGG + Intergenic
1093121229 12:15273967-15273989 AAGTGAAAGCAGTTGTAAGATGG + Intronic
1093658920 12:21731158-21731180 AACTGTAGGTAGTTGGAATTAGG - Intronic
1094419351 12:30254567-30254589 TACTGAAGGGAGTAGGAAGAGGG - Intergenic
1094526087 12:31232159-31232181 CACTGAAGGCAGCAGGAAGCTGG + Intergenic
1095236772 12:39805707-39805729 AAGTGAAGGGAGTTGGAGGAGGG + Intronic
1095601283 12:44016085-44016107 AACTGAAGGGAGTTGGGAGGAGG - Intronic
1095934981 12:47669080-47669102 ACCTCAAGCCAGTTTGAAGCAGG - Exonic
1095935097 12:47670892-47670914 AACTGAAGGCAAGTGGAATAAGG + Intronic
1097457500 12:59817803-59817825 AACTGAAAGAATTTGGAAGAGGG + Intergenic
1101048894 12:100840400-100840422 TATTGAAGGCAGTATGAAGCAGG + Intronic
1101447539 12:104748138-104748160 AGATGAAGGGAGTTGGAGGCTGG + Intronic
1101905565 12:108822632-108822654 AGCTGAAGGCAGTTAGAAAGAGG - Intronic
1103672158 12:122626720-122626742 AACAGAAGGGAGGTAGAAGCGGG + Intergenic
1103830544 12:123775674-123775696 AAATGAAGGCAGGTTTAAGCAGG + Intronic
1105384862 13:19920426-19920448 AAGGGAAGGCAGGTGTAAGCAGG + Intergenic
1109658780 13:65430654-65430676 AAATGAAGAAAGTTGTAAGCTGG + Intergenic
1110545967 13:76755621-76755643 AAGTAAAGGCATTTGGAAGGAGG - Intergenic
1110565920 13:76957436-76957458 TAATGTAGTCAGTTGGAAGCAGG - Exonic
1111902378 13:94215231-94215253 AAATGCAGCCAGTTAGAAGCTGG - Intronic
1113063405 13:106349506-106349528 GACTGAAGGCTGTGGGAACCTGG - Intergenic
1113890553 13:113733064-113733086 AACTGGAGGCAGCTGGAGGCTGG + Exonic
1115866136 14:37748541-37748563 AACTTGAGGCAGTGGGAAGAAGG - Intronic
1116053429 14:39833698-39833720 AGATGAAGGTAGTTGGAAGGGGG + Intergenic
1119318601 14:73715999-73716021 AGCTGAATGCAGATGGATGCTGG + Exonic
1119414926 14:74463501-74463523 AACTGACGACAGTGGGAAGAGGG - Intergenic
1121109471 14:91302983-91303005 AACTGAAGACAGTAGTAAGAGGG - Intronic
1121275621 14:92665819-92665841 AATTGAAGTCAGTTGGGATCTGG - Intronic
1121777804 14:96602235-96602257 AAGTGAAGCCACCTGGAAGCTGG + Intergenic
1122751034 14:103933310-103933332 AACACAAGGCAGAAGGAAGCTGG - Intronic
1122998984 14:105281802-105281824 AAGTGAAGCCAGTGGGCAGCAGG + Intronic
1123875421 15:24618984-24619006 AACTGAAGGAAGTTGGGATGTGG - Intergenic
1124961304 15:34397909-34397931 AACTGGAGGCTGTAGGCAGCAGG + Intronic
1124977932 15:34544133-34544155 AACTGGAGGCTGTAGGCAGCAGG + Intronic
1125190440 15:36986511-36986533 CACTGAAGGAAGCTGGAAGCCGG - Intronic
1126049208 15:44671561-44671583 AAATAAAGGCAGAAGGAAGCAGG + Intronic
1126300309 15:47187117-47187139 AACTGAAGGAAGATGGAAAGGGG + Intronic
1126534781 15:49749618-49749640 AACTGAAGGGACTTGGGAGAGGG - Intergenic
1127010861 15:54626040-54626062 AAAGGAAGGAATTTGGAAGCTGG + Intronic
1127305432 15:57700979-57701001 AAAAGAAGGCAGGTGGAAGCTGG + Intronic
1127766393 15:62189301-62189323 AACCGAAGAAAGATGGAAGCAGG + Intergenic
1129599606 15:76990925-76990947 CAGGGGAGGCAGTTGGAAGCAGG - Intergenic
1129651188 15:77491315-77491337 AACTGAAGGCAGCTGGGTCCAGG + Intergenic
1129673367 15:77619369-77619391 AATTGAAGTATGTTGGAAGCCGG + Intronic
1129824958 15:78628886-78628908 AACTGCAGGAAGTGGGAAGCTGG + Intronic
1133056382 16:3147490-3147512 AAGTGAGGGCAGTAGGAGGCCGG - Intronic
1137616219 16:49848819-49848841 ATCTGGAGGCAGTTGGCAGCAGG + Intronic
1137916536 16:52436773-52436795 AACTGTTTGCAGTTAGAAGCAGG - Intergenic
1139842709 16:69894454-69894476 AACTGAAGGCTGCTGAAACCTGG + Intronic
1140282947 16:73572322-73572344 AACTGAAGACAGCTGAATGCAGG - Intergenic
1140339852 16:74146780-74146802 TACTGAAAGAAGCTGGAAGCAGG + Intergenic
1141673155 16:85503360-85503382 AGCTGAGGGCAGGTGGAGGCTGG - Intergenic
1143864314 17:9912741-9912763 AACTGAAGGAAGCAGCAAGCTGG + Intronic
1144210678 17:13012517-13012539 GACTGAAGGCAGAAGGCAGCAGG - Intronic
1145213251 17:21032122-21032144 CACTGTAGGCAGTTGAAAGACGG - Intronic
1146814051 17:35928329-35928351 AACTGAAGGGAGTTTCAAACAGG + Intronic
1148103891 17:45109137-45109159 AAAGGAAGGCCTTTGGAAGCTGG - Exonic
1149543925 17:57489214-57489236 AACTCATGGAAGTGGGAAGCAGG - Intronic
1151062625 17:71113621-71113643 AAATCAAGGCAGCTGGAGGCAGG + Intergenic
1151624261 17:75266844-75266866 AGCTGAGGCCAGTTGGGAGCAGG + Exonic
1151940500 17:77288639-77288661 AACCCAAGCCAGTTGGAAGTGGG + Intronic
1152164402 17:78692933-78692955 AAGTGAAGGAAGGAGGAAGCAGG + Intronic
1152995181 18:399881-399903 AACTGGGGGCTGTTAGAAGCTGG - Intronic
1154121771 18:11658017-11658039 AACTGAAGTGAGTTGAAAGCAGG - Intergenic
1154123484 18:11670175-11670197 AAGTGCAGGCAGTTAGAGGCTGG - Intergenic
1154293318 18:13129455-13129477 AAGTGAAGGCACTTGGAAGTAGG + Intergenic
1155444710 18:25899105-25899127 GTCTAAAGGCAGGTGGAAGCTGG + Intergenic
1155925280 18:31649409-31649431 AAATGCAGGTAGGTGGAAGCAGG - Intronic
1156520843 18:37721298-37721320 CACTGAAGGCAGGTGGAGGGAGG - Intergenic
1158183288 18:54742435-54742457 AACGGAAGGCAGGAGGAAGTTGG + Intronic
1158337265 18:56426406-56426428 CACTGAATTCAGGTGGAAGCAGG - Intergenic
1158408182 18:57179124-57179146 AACAGAAGGCAGAAAGAAGCAGG + Intergenic
1160819481 19:1051347-1051369 TCCTGAAGGCAGGGGGAAGCCGG + Intronic
1161064104 19:2229130-2229152 ACCAGAAGGAAGTTGGAAGCAGG + Intronic
1164088885 19:21930280-21930302 ATCTGGATGCAGTTGAAAGCTGG + Intergenic
1166080965 19:40443992-40444014 AAGTGGAGGGAGTTTGAAGCTGG - Intronic
1166909487 19:46141725-46141747 CAGTGAGGGAAGTTGGAAGCAGG - Intergenic
1166923792 19:46251500-46251522 CAGTGAGGGAAGTTGGAAGCAGG + Intergenic
1167776257 19:51559527-51559549 ATCTGAACCTAGTTGGAAGCTGG + Intergenic
925875473 2:8308055-8308077 ATCAGAAGGCACTTGGAAACAGG - Intergenic
926795667 2:16617101-16617123 AACTGAAGACAGTTGATAGATGG + Intronic
926939529 2:18120131-18120153 AACTGAAGGCAGTTGGAAGCTGG + Intronic
926963586 2:18386151-18386173 AACTGGAGGGAGTGGGAAGGAGG + Intergenic
927781032 2:25939495-25939517 AATTGAAGACAGTGTGAAGCAGG - Intronic
929751047 2:44714078-44714100 AAGTGAGGGCAGTTGGAAATTGG + Intronic
929811582 2:45193368-45193390 AAAGGAAGGCAGAAGGAAGCAGG + Intergenic
929957537 2:46470166-46470188 AGCTGAAGTCAGGAGGAAGCAGG + Intronic
931113258 2:59136236-59136258 AACTTAATGCTGCTGGAAGCAGG - Intergenic
935976876 2:108586902-108586924 AGTGGAAGGCAGATGGAAGCTGG - Intronic
936083029 2:109447948-109447970 AAATGCAGGCAGATGGCAGCAGG + Intronic
937993932 2:127679309-127679331 AAGAGACGGCAGTTGGAAGTGGG + Intronic
938997105 2:136691701-136691723 AAATGTGGGCAGTTGGAAGTTGG + Intergenic
939536165 2:143431956-143431978 ATCTGAAGTCAGTTGGAAGCTGG + Intronic
940398465 2:153220969-153220991 AACTGGAGCCTGTTGGAAGGTGG + Intergenic
940948045 2:159640689-159640711 CACTGAAGGCAGTAGTAAGAAGG + Intergenic
943347338 2:186754940-186754962 AACAGAAGGAAGATGGAGGCTGG + Intronic
944987080 2:205189523-205189545 CAGTGAAGGCTGTTGGAAGCTGG - Intronic
946940362 2:224763680-224763702 AACTGGAGGCAGAATGAAGCTGG + Intergenic
948326909 2:237131812-237131834 AACTGATGGAAATTGGGAGCCGG - Intergenic
948733445 2:239982013-239982035 AGCAGAAGGTAGTTGGCAGCCGG - Intronic
1168863216 20:1061128-1061150 CACAGAAGACAGCTGGAAGCAGG + Intergenic
1168898361 20:1339157-1339179 CACTGAAGCCAGTTTGAAGTGGG + Intronic
1168976328 20:1968792-1968814 AACTGCAGGCAACTGGAAGGTGG - Intergenic
1169332956 20:4730851-4730873 AACTAGAGGAAGCTGGAAGCAGG + Intergenic
1170093603 20:12620422-12620444 AACTTAAGGTAGGTGGAAGTAGG + Intergenic
1173316071 20:41944689-41944711 CACTGATGGCAGTTGGAAACTGG - Intergenic
1174357114 20:50005852-50005874 GACTGAAGGAAGTGGGAGGCCGG + Intergenic
1174429239 20:50456001-50456023 ACCGGAAGGAAGTGGGAAGCTGG + Intergenic
1174753262 20:53133168-53133190 AACTGAAGCCAGTTGGAAGAAGG - Intronic
1175040061 20:56040595-56040617 AACTGAAGACATTTGGAGACTGG + Intergenic
1175572504 20:60034638-60034660 ACCTGAAGGCAGCTGGGGGCTGG - Intergenic
1176374602 21:6080810-6080832 AACTGAAGGAAGTGGAAAGGAGG - Intergenic
1177292049 21:19126254-19126276 CATTGAAGGAAGCTGGAAGCAGG + Intergenic
1177859448 21:26435735-26435757 AGCTGATTGGAGTTGGAAGCTGG + Intergenic
1178073192 21:28992176-28992198 AACTGAAGAGCGTTGGGAGCCGG + Intronic
1179748873 21:43457435-43457457 AACTGAAGGAAGTGGAAAGGAGG + Intergenic
1182311309 22:29409858-29409880 AACTGAGGCCAGTTGGATGATGG + Intronic
1182437861 22:30342054-30342076 AACTGAAGTCTTTTGGGAGCAGG + Intronic
1182617425 22:31597060-31597082 TACTGAAGCCATTTGGAAACGGG - Intronic
1183684740 22:39355216-39355238 CTCTGAGGGCAGTGGGAAGCTGG + Intronic
950783258 3:15410627-15410649 AACTGACTGCAGTTGAAAACAGG + Intronic
953007856 3:38994780-38994802 ACCTGGAGACAGATGGAAGCTGG + Intergenic
955054241 3:55442005-55442027 CACTGAAGGCAGGTGCAGGCAGG - Intergenic
956064355 3:65381251-65381273 ATCTGAAGGCAGTTGGAGGAAGG + Intronic
957327276 3:78712358-78712380 AATTGAAGCCATTTGGTAGCAGG - Intronic
957405177 3:79766730-79766752 AACCGAAGGCTCATGGAAGCGGG + Intronic
959156963 3:102678809-102678831 AACTGAAGGCAGTTAGGAAATGG - Intergenic
959197215 3:103199846-103199868 ATGGGAAGGCATTTGGAAGCTGG - Intergenic
959320807 3:104872639-104872661 AACTGGTAGCAGTGGGAAGCTGG - Intergenic
961549459 3:127660750-127660772 GACTGAAGGCAGCAGCAAGCTGG - Exonic
961653093 3:128426921-128426943 CACAGAAGGCCTTTGGAAGCTGG - Intergenic
961673394 3:128550482-128550504 CACTGAAGCCAGTTTGAAGCTGG + Intergenic
963788465 3:149558910-149558932 AACTGAAGACATTTCGAATCTGG + Intronic
965179476 3:165383574-165383596 AAGTGAAAGCAGGGGGAAGCAGG + Intergenic
966285609 3:178291851-178291873 AACTGAAAGCAGATATAAGCTGG + Intergenic
966921246 3:184613075-184613097 AACTGAAGACATTGGGGAGCTGG - Intronic
967196513 3:187030959-187030981 AATTGAAGGCAGTGGGCAGTGGG + Intronic
968497464 4:926697-926719 AAGTGAAGGCGGTTGGTACCAGG + Intronic
968874142 4:3256372-3256394 AAATGAAAGCAGATGGAAACGGG + Intronic
969093164 4:4711995-4712017 AACTGAAAGCTGTTGGCTGCAGG - Intergenic
969171641 4:5368718-5368740 AACTGCAGGAAGGTGGAAGATGG - Intronic
975711411 4:77163646-77163668 AACTGAAGGCATTCCGAAGGAGG + Intronic
975922367 4:79407495-79407517 AACTGAAGACATTTGGAAGAAGG + Exonic
976886785 4:89994912-89994934 AACTGAAGGCAATTAAAAGTAGG - Intergenic
977247637 4:94652173-94652195 AACAGAATGCAGTTTGAAGTTGG + Intronic
979807961 4:124998415-124998437 AATTGAAGTCATGTGGAAGCTGG + Intergenic
979981177 4:127257127-127257149 AAATGACTGCAGATGGAAGCTGG + Intergenic
980182051 4:129413472-129413494 AACTGAAGCCAGGTGAAAGCAGG - Intergenic
980427819 4:132648938-132648960 AGCTGGAGGCAGTAGGAAGTAGG - Intergenic
982130922 4:152227976-152227998 AGCTGAGGGCTGCTGGAAGCGGG - Intergenic
985578935 5:686544-686566 ACCTGCAGGCAGCTGGAACCAGG + Intronic
986456762 5:7927640-7927662 CACAGAAGGCAGGTGGACGCGGG + Intergenic
986923498 5:12717304-12717326 AGCTGTAGGCAGTTGGGTGCTGG + Intergenic
990523655 5:56604205-56604227 AGCTAAGGGCAGTTGGAAGCTGG + Intronic
990636779 5:57736837-57736859 AGCTGAAAGCAGTTGGCAACAGG - Intergenic
994276877 5:97849374-97849396 ACCTGAAGGCAGGTGGCAGAAGG + Intergenic
995213382 5:109566994-109567016 AACTGAGGGCAGTGGGAGGCAGG + Intergenic
995596144 5:113750032-113750054 AACTGAAGGCTGTTACAAGAAGG - Intergenic
998262357 5:140641193-140641215 ACCTGAAGAGAGTGGGAAGCTGG + Intronic
999472506 5:151867950-151867972 CACTGTAGACAATTGGAAGCAGG + Intronic
1000151590 5:158507116-158507138 AAATGAACCCAGGTGGAAGCAGG + Intergenic
1000745537 5:165028039-165028061 AATGGAAAGCAGTTGGAAGCTGG + Intergenic
1001299591 5:170524104-170524126 ATCTGGAGGCAGTGGGAGGCTGG - Intronic
1001426115 5:171623770-171623792 AACTGCAGGCAGCTCAAAGCAGG + Intergenic
1003142219 6:3481150-3481172 AAGTGAAGGCAGCAGGAAGGGGG - Intergenic
1003688036 6:8323774-8323796 AAATGAAGGCAGGTGGCAGAGGG - Intergenic
1005000917 6:21240742-21240764 AACTGAGGGGAGTGGGAAGAAGG + Intergenic
1006806039 6:36789857-36789879 ATCTGAAGGCACTTGACAGCGGG - Intronic
1007514803 6:42402510-42402532 GACTGAAGGCAGGGGGAAGGGGG + Intronic
1010496170 6:76535937-76535959 AACTGAATCCAGTGGCAAGCGGG - Intergenic
1013929526 6:115514402-115514424 AACAGAAGGTAGTTGGATTCTGG - Intergenic
1014273629 6:119362541-119362563 AACTGAAAGAATTTGGAATCAGG - Intergenic
1014787922 6:125639186-125639208 AGTTGAAGACAGTTGGAACCAGG - Intergenic
1016911168 6:149200658-149200680 AATTGAAGGCTGTTGGTAGGGGG - Intergenic
1017849351 6:158290575-158290597 AACAGAAGGGAGGTGGGAGCAGG - Intronic
1019398491 7:836567-836589 GTCTGAAGGCAGTTTGTAGCTGG + Intronic
1019633897 7:2065223-2065245 AGCTGAAGGCAGATGGAGACTGG - Intronic
1021396767 7:20158973-20158995 AAACAAAAGCAGTTGGAAGCAGG - Exonic
1022590910 7:31661829-31661851 AACTGAAGGGAGTAGGCAGAGGG - Intergenic
1023636979 7:42221951-42221973 AACTGAAGTCATTTGCCAGCAGG + Intronic
1024064613 7:45722021-45722043 AGGTGAGGGCAGTGGGAAGCTGG + Exonic
1028077642 7:86535040-86535062 ACCTGAAGGCAGTAGCAAGGAGG + Intergenic
1028966076 7:96802842-96802864 AAATGAACTCATTTGGAAGCAGG + Intergenic
1029272813 7:99386903-99386925 AATTGAAGCCAGTTTGAATCCGG - Intronic
1029424259 7:100486609-100486631 AACACAAGGCAGTTGGGGGCAGG - Intronic
1030634275 7:111931042-111931064 AACAGAAGGCAGATAGATGCAGG + Intronic
1031667776 7:124505736-124505758 AAATGAAAGTAGTTGGAAGGAGG - Intergenic
1031729619 7:125282635-125282657 ATCTGATGGGAGTTGGAGGCTGG - Intergenic
1032874569 7:136023827-136023849 AGCTGAAGGCAGATAGAAGACGG - Intergenic
1033156764 7:138963431-138963453 AACTGAACACAATTGGAAGAGGG + Intronic
1034521576 7:151624669-151624691 AACTGAAGGCAGTAGCAAGTGGG - Intronic
1035416720 7:158695536-158695558 CACTGAAGGCTGTTTGGAGCTGG + Intronic
1035672694 8:1432384-1432406 AACTGAAAGAAGTTAGAATCTGG + Intergenic
1038577635 8:28718264-28718286 AAGTGAAGGAAGTTGGAAAAGGG - Intronic
1039155799 8:34555089-34555111 AATTGAAAGCAGTTGGCAGTAGG - Intergenic
1039544921 8:38402947-38402969 AACTGAATGAACTTGGAAGCAGG - Intronic
1039918238 8:41875318-41875340 AACTGGAGGCAGGAGGAGGCAGG + Intronic
1040448256 8:47518521-47518543 TGCTGAAGGCATTGGGAAGCAGG + Intronic
1041015090 8:53585061-53585083 ACCTGAGGGCAGTGGGCAGCTGG - Intergenic
1042204337 8:66313209-66313231 AACTGAGGGAATTTGGAGGCCGG - Intergenic
1042337090 8:67640308-67640330 TACTGAAGGCAGCTCGATGCTGG - Intronic
1043138098 8:76553091-76553113 ATGTGATGGCATTTGGAAGCGGG - Intergenic
1043846151 8:85166243-85166265 ATCTGAAGGCATTTGGAGGGTGG - Intergenic
1044801632 8:95963182-95963204 TAATGAAGGCAGTAGGAAGAAGG + Intergenic
1046161337 8:110369575-110369597 GACTGTAGGGAGATGGAAGCTGG - Intergenic
1046453856 8:114432962-114432984 AACAAAAGGCAGAGGGAAGCTGG + Intergenic
1047797841 8:128276375-128276397 TACTGAAGGGAGTTGTAACCTGG + Intergenic
1048715344 8:137262654-137262676 ATCTGAAAGCAGTTGGAAAATGG + Intergenic
1048894227 8:138975015-138975037 GACTGAAGGCACAGGGAAGCTGG + Intergenic
1049505438 8:142994053-142994075 AACTGGAGGCAGCTGGAGGCAGG + Intergenic
1050947717 9:11547736-11547758 AACTGCAAAAAGTTGGAAGCAGG + Intergenic
1051059811 9:13032867-13032889 AACAGCAGGTAGTAGGAAGCTGG - Intergenic
1052016866 9:23479140-23479162 ACCTGAATGAACTTGGAAGCAGG - Intergenic
1055029338 9:71757626-71757648 AATTCAAGGCAGTTAGAATCTGG - Intronic
1057518082 9:95738336-95738358 AACAGATGGCACTTGCAAGCAGG + Intergenic
1060078947 9:120622988-120623010 AAATGGAGGCATTTGAAAGCAGG + Intronic
1060750470 9:126165272-126165294 AACAGGAGGAAGTGGGAAGCCGG - Intergenic
1061192083 9:129087922-129087944 AAATGAAGGCAGGTGGAGGCCGG - Intronic
1061986729 9:134134578-134134600 AATTGAGGGCAGTGGGAAGCTGG + Intergenic
1062234596 9:135501743-135501765 CACAGAAGGCACTTGGGAGCAGG + Intronic
1062383394 9:136298472-136298494 GACTAAAGGAAGTCGGAAGCAGG - Intronic
1186745989 X:12569921-12569943 AACCCAAGGCAGCTGGAAGGAGG - Intronic
1187071694 X:15894615-15894637 AACTGAAGACAGTGGGAACAGGG + Intergenic
1187564949 X:20440139-20440161 AACTGAAGGCAGTTGTGTACTGG - Intergenic
1187982505 X:24773206-24773228 AACTGAATGCAGATAGAATCAGG + Intronic
1190436848 X:50433972-50433994 AAAAGAAGGCAATTGGAAGCAGG - Intronic
1190653201 X:52587642-52587664 AACTTAAGGAAGAAGGAAGCAGG + Intergenic
1191781050 X:64866161-64866183 AAATGAAGTAAGCTGGAAGCTGG - Intergenic
1194985328 X:100483991-100484013 AGATGAAGACAGCTGGAAGCAGG + Intergenic
1196097610 X:111816725-111816747 AGTTCAAGGTAGTTGGAAGCTGG + Intronic
1196846182 X:119898414-119898436 AACTGATGGCCGTTGGAGCCAGG + Intronic
1200838118 Y:7752770-7752792 AACTGAAGGAGGCTGGAAGTGGG + Intergenic
1201917846 Y:19201977-19201999 AACTCAAGGCACTTGGAAACAGG - Intergenic
1202024636 Y:20507879-20507901 AACTGCTGACAGATGGAAGCAGG + Intergenic