ID: 926940112

View in Genome Browser
Species Human (GRCh38)
Location 2:18126638-18126660
Sequence AGGGTCTGGGTGGGAATAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 1, 2: 4, 3: 33, 4: 337}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926940103_926940112 5 Left 926940103 2:18126610-18126632 CCAAGAAGCCAGTCAGGAATCTG 0: 1
1: 0
2: 0
3: 14
4: 245
Right 926940112 2:18126638-18126660 AGGGTCTGGGTGGGAATAGAGGG 0: 1
1: 1
2: 4
3: 33
4: 337
926940104_926940112 -3 Left 926940104 2:18126618-18126640 CCAGTCAGGAATCTGTGAGAAGG 0: 1
1: 0
2: 1
3: 13
4: 228
Right 926940112 2:18126638-18126660 AGGGTCTGGGTGGGAATAGAGGG 0: 1
1: 1
2: 4
3: 33
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926940112 Original CRISPR AGGGTCTGGGTGGGAATAGA GGG Intronic
900387970 1:2419287-2419309 AGGGGCTGGCAGGGGATAGATGG - Intergenic
900703219 1:4060774-4060796 AGGGTCTTCGTGGAAACAGACGG - Intergenic
900742176 1:4337315-4337337 TGGGGCTGGGTGGGAAGAGGGGG + Intergenic
902106713 1:14043070-14043092 AAGGACTGGGTGGGGATTGAAGG - Intergenic
903061221 1:20670248-20670270 AGGGTCTAGGTGCCAATGGAGGG + Intronic
903474557 1:23610707-23610729 AGGCTCTGGCAGGGAACAGATGG + Intronic
903545708 1:24122109-24122131 AGGGTCAGGGTGGGAAAAGAAGG + Intronic
904927082 1:34057724-34057746 AGAGTCTGGGTGGGCAGAGCTGG - Intronic
905405368 1:37728826-37728848 AGGGTCTGGGTGGGGATAGAGGG + Intronic
905878858 1:41450619-41450641 AGGGTCTGAATGGGAGTATAAGG + Intergenic
906129979 1:43450278-43450300 AGGGCATGGGTGGGGATAGGAGG - Intronic
906220194 1:44072242-44072264 TGGGTTTGGGTGGGAAGACAAGG + Intergenic
906533805 1:46540094-46540116 AGGGACTGAGAGGGAACAGAAGG - Intergenic
906882804 1:49610876-49610898 GGGGTCTGGCTGGAAATAGATGG + Intronic
907475400 1:54701960-54701982 GGGGTCTGGCTGGGAAGAGTCGG + Intronic
910705578 1:90126032-90126054 AGGGGCGGGGTGGGAAGGGATGG + Intergenic
910976313 1:92909807-92909829 AGGGTGTAGGGGGGAATAAAAGG + Intronic
911601497 1:99852826-99852848 AGGTCCAGGGTGGGAATACATGG - Intronic
911895798 1:103433466-103433488 GGGGTGAGGGTGGGGATAGAAGG - Intergenic
912430440 1:109625821-109625843 AGGGTCTGGAAGGGTATGGAGGG - Intronic
912518357 1:110229567-110229589 AGAGGCTGGGTGGGAATGGCAGG - Intronic
912763554 1:112389019-112389041 AGGGGAGGGGTGGGAAGAGAGGG + Intergenic
913063001 1:115225077-115225099 AGGCTTTGGGTGGGTATTGATGG + Intergenic
914754441 1:150554651-150554673 AGGGTCGGGGTGGGAGGAGGAGG + Intronic
915913327 1:159927668-159927690 AGGGCCTGACTGGGAATAGATGG + Intronic
915942242 1:160125684-160125706 AGGGTCTGGGAGGGCCAAGAAGG + Intronic
916492581 1:165314986-165315008 AGGGTCTGGGAAGCAAGAGAAGG - Intronic
916517237 1:165530901-165530923 AGAGTATGGGTGGGCAAAGATGG + Intergenic
918301984 1:183212957-183212979 GGGGTCTGAGTGAGAAGAGAAGG - Intronic
918423758 1:184387704-184387726 AGGGTGCGGGTGGGAAGGGAGGG - Intronic
918535419 1:185569032-185569054 AAGGTCTGGGAGGTAATGGAAGG - Intergenic
918883221 1:190154392-190154414 TGGGTGTAGGTGGGAAAAGAGGG + Intronic
920205540 1:204288394-204288416 GCGGCCTGGGTGGGACTAGAGGG - Intronic
920969887 1:210734286-210734308 GGGGGCTGGATGGGAATAGGTGG - Intronic
920971786 1:210749145-210749167 AGGGGCTGGGTGGACATAGTGGG - Intronic
921261557 1:213388996-213389018 GGGGTTTGGGTAGGAATAGTGGG + Intergenic
921299874 1:213741787-213741809 AGGGTCGGGGTGGGAAGTGGAGG + Intergenic
922002496 1:221494318-221494340 AGGGTAAGAGTGGGAAGAGATGG - Intergenic
922085046 1:222338497-222338519 AGGGTGTGGGTGGATATAAAGGG - Intergenic
923575112 1:235151293-235151315 AGGGTTGGGGTGAGAATGGATGG + Intronic
923802685 1:237225704-237225726 ATGGAGTGGGTGGGACTAGAGGG + Intronic
924628452 1:245715123-245715145 AGGGGCTGGTTGCGAATTGAGGG - Intergenic
1063576900 10:7270267-7270289 AGGCTCTGGGTGGAAGCAGAGGG - Intronic
1064031375 10:11885397-11885419 AGGGGATGGGTGGGTAGAGATGG + Intergenic
1064031396 10:11885475-11885497 AGGGGATGGGTGGGTAGAGATGG + Intergenic
1069874166 10:71551532-71551554 AGGTTCTGGTAGGGAAGAGAAGG + Intronic
1071435609 10:85646198-85646220 TGGGTCTGGGAGGGAAAGGATGG + Intronic
1071449963 10:85784737-85784759 AGAGGCTGGGTGGGATTTGAAGG + Intronic
1071822484 10:89292521-89292543 ATGGTATGGGTGGCAGTAGAAGG + Intronic
1073318002 10:102596457-102596479 AGGGTCTCGATGGGGAGAGAAGG + Intronic
1073498878 10:103918339-103918361 GGGGTCTGGGTGGGATGAGGCGG - Intergenic
1073961825 10:108940095-108940117 AAGGGTGGGGTGGGAATAGAAGG + Intergenic
1075633421 10:124015072-124015094 GGGGTTGGGGTGGGAATTGAGGG - Intronic
1075968694 10:126634819-126634841 AGTGTCTGGGTGAAAATAGGAGG - Intronic
1076980268 11:200390-200412 AGGGTCTGTGTGGGGAGAGATGG + Intronic
1077881177 11:6351584-6351606 AGGGCCTGGATGGAAATTGAGGG + Intergenic
1077993029 11:7428993-7429015 AGGGTCTGTGTTGGAATAGGTGG + Intronic
1078449770 11:11432058-11432080 AGGGTCTGGCTAGGGACAGATGG + Intronic
1078582260 11:12547592-12547614 TAGATCTGTGTGGGAATAGAAGG + Intergenic
1078613157 11:12839897-12839919 AGGGTGAGAGTGGGAACAGATGG + Intronic
1078855759 11:15205581-15205603 AGGGTCTGGTGGGGAAGGGAGGG + Intronic
1079090560 11:17477133-17477155 GGAGTCTGGGTGGGAAAGGAGGG + Intergenic
1079318284 11:19428745-19428767 AGAATCAGGGTGGGAAGAGAAGG + Intronic
1083197904 11:61102128-61102150 GGGGTCTGGGTGGGGAGAGGCGG - Intergenic
1083464364 11:62835287-62835309 AGGGACAGGGTTGGAACAGACGG + Intronic
1084013830 11:66367368-66367390 GGGCTCTGGCTGGGAACAGATGG + Intronic
1085512251 11:77094315-77094337 AGGGTTTGGGTGGGAAAGAATGG + Intronic
1088562959 11:111134490-111134512 AAGTTCTGGGAGGGAATTGATGG - Intergenic
1088946045 11:114513294-114513316 AAGGTCTGGGTGGGATCAGCTGG + Intergenic
1089678785 11:120108032-120108054 GGGGGCTGGGTGGGCACAGAAGG - Intergenic
1090989005 11:131799498-131799520 GAGGTCTGGGTTGGAAAAGAGGG + Intronic
1091219595 11:133922218-133922240 AGGGTCTGGAAGGAAAGAGAAGG + Exonic
1091413753 12:262141-262163 AGGGTCTGGGAGGGTGGAGAAGG - Intronic
1091737891 12:2938299-2938321 AGGGGTTGGGTGGGAAGAGGAGG + Intronic
1091778956 12:3201851-3201873 GGGGCCTGGGTGGGAAAGGAGGG + Intronic
1092255926 12:6926980-6927002 AGGTTCTGGGTGAGAAAGGAGGG - Intronic
1093744435 12:22723623-22723645 AGTGTCTAAGTGGGTATAGAAGG - Intergenic
1094019125 12:25895584-25895606 AGGGGCTGGGTGGGATTTGGAGG + Intergenic
1094212765 12:27909966-27909988 TGGGCCTGGGTGAGAATAGCAGG + Intergenic
1095465975 12:42488399-42488421 AGGGTTAGGGTGGGCAAAGATGG - Intronic
1097342453 12:58454428-58454450 AGGGAATGGGAGGGAATGGAAGG - Intergenic
1097895817 12:64824404-64824426 AAGATCTGGGAGGGAACAGAGGG - Intronic
1098790306 12:74814682-74814704 AGGATGTGGGTGGGAACAAAAGG + Intergenic
1099695103 12:86009526-86009548 AGGTTCTGGGTTGCAATACAAGG - Intronic
1099963325 12:89418107-89418129 AGGGTCAGGGAGTGAATGGAGGG + Intergenic
1100218483 12:92478479-92478501 AAGGTCTGAGTAGGAATAAATGG + Intergenic
1100493033 12:95099368-95099390 AGTGTGTTGGTGGGAAGAGATGG + Intronic
1102042602 12:109810324-109810346 AGGGTCTGGGAGGGAGAAGAGGG + Intronic
1102456678 12:113075286-113075308 AGGGTCTGGGTGGGACCCCAGGG - Intronic
1102461729 12:113104104-113104126 AGGGGGCGGGTGGGAACAGAGGG + Intronic
1104842646 12:131832155-131832177 AGGATCTGGGGGGGAAGGGAAGG + Intronic
1105437622 13:20391335-20391357 GGGGTCTGGGTGGGGAAGGAAGG + Intergenic
1105620910 13:22065160-22065182 AGGGTGAGGGTGGGAGTGGAAGG + Intergenic
1106769245 13:32945593-32945615 AGGCTTGGGGTGGGGATAGATGG + Intergenic
1106923415 13:34588682-34588704 AGAGGCTGGTTGGGGATAGAGGG + Intergenic
1108547053 13:51506140-51506162 AGGGTGAGGGTGGAAAAAGAAGG - Intergenic
1109546265 13:63840667-63840689 AGAGTCTGGGGGGGAAGAGGGGG - Intergenic
1110889821 13:80684813-80684835 AGGACCTGGGTGGGTACAGAAGG + Intergenic
1112565425 13:100547831-100547853 GGGGCCTGGGTGGGCAGAGAAGG - Intronic
1113701218 13:112390103-112390125 AGGGGCTGAGTGGGAAGAGAAGG + Intronic
1113827488 13:113268007-113268029 ATGGTCTGGGTGAGGACAGACGG + Intergenic
1114380619 14:22199384-22199406 AGGGTCGGGGTGGAAGTATATGG + Intergenic
1115461083 14:33661873-33661895 TGGGAGTGGGTGGGAAGAGAGGG - Intronic
1120074347 14:80138727-80138749 AGCTTCTGGGTGGCAAGAGAGGG - Intergenic
1121198404 14:92096166-92096188 AGGGTGGGGGTGGGGAAAGAAGG + Intronic
1121431073 14:93888839-93888861 AGGGTCGGGGTGGGTCTAGGGGG + Intergenic
1122301851 14:100735870-100735892 GGGTTCTGGGTGGGCAAAGAGGG - Exonic
1122416294 14:101551223-101551245 AGGGTTGGGGTGGGAGTAGGGGG - Intergenic
1122880017 14:104686478-104686500 TGGGTGTGTGTGGGAATGGATGG + Intergenic
1123780478 15:23622001-23622023 AGGGCATGGGTGGGAAGAAATGG - Intronic
1125269945 15:37927883-37927905 AGGCTGGGGGTGGGAAAAGAGGG + Intronic
1128613659 15:69093175-69093197 AGTCTCTGGGAGGGAATGGAAGG + Intergenic
1128662824 15:69514696-69514718 AGGGACTGAGAGGGAAGAGATGG - Intergenic
1128678609 15:69629899-69629921 AGGGTGTGGGAGAGAGTAGAGGG + Intergenic
1129189872 15:73930990-73931012 AGGGCCTGGTTGGTAATAGCAGG - Intronic
1129833453 15:78685727-78685749 AGTCTCTGGCTGGGAATGGATGG + Intronic
1131109964 15:89758826-89758848 AGGGACTGGCTGGGAAATGAGGG - Intergenic
1132397272 15:101483055-101483077 AGGTTCTGGGTGTGAACTGAGGG - Intronic
1133217123 16:4299347-4299369 CGGGTCTGGCTGGGAAGAGGTGG - Intergenic
1133568724 16:7020761-7020783 AGGATGTGGGTGGGAATGCAGGG - Intronic
1134561832 16:15217496-15217518 AAGGTCTGGGTGGCAATTGATGG - Intergenic
1134901171 16:17939376-17939398 AGGCTCTGAGTTTGAATAGAGGG - Intergenic
1134922370 16:18129120-18129142 AAGGTCTGGGTGGCAATTGATGG - Intergenic
1135718741 16:24795905-24795927 AGGGTCTGAGTGGCAAAAAAAGG + Exonic
1137522615 16:49207939-49207961 AGGGCAAGTGTGGGAATAGATGG + Intergenic
1137675057 16:50299974-50299996 AGGGATTGGGGGGGCATAGAAGG + Intronic
1138311422 16:56026777-56026799 GGGGGGTGGGGGGGAATAGATGG + Intergenic
1139446375 16:67001038-67001060 GGGGACTGGGTGGGAAGGGAGGG + Intronic
1140667554 16:77241496-77241518 TGGGTCTGGGTGTGAATGGCAGG + Intergenic
1141763591 16:86044616-86044638 AGAGTGTGGGTGGGAATCCAGGG - Intergenic
1141881830 16:86865336-86865358 AGGGGCTGGGAGGGCACAGAGGG + Intergenic
1142033602 16:87850574-87850596 AGGCTCTGGGAGAGAAGAGAAGG + Intronic
1142105570 16:88300679-88300701 AGGGGCTGGGTGGGTGAAGAAGG - Intergenic
1142208226 16:88793985-88794007 AGGGAATCGGTGGGAATATAAGG - Intergenic
1142691339 17:1607596-1607618 AGGGTGTGGGTGTGAATGGTGGG + Intronic
1142854832 17:2723879-2723901 AGGGTCAGGGTGGGGGTAGAAGG + Intergenic
1143681263 17:8477639-8477661 AGGGTGGGGGTGGGAAGGGAAGG + Intronic
1145172744 17:20673741-20673763 AGGGACTTGGTGGGAAGTGATGG + Intergenic
1145994586 17:29098074-29098096 AGGGCCTGGGTGAGAACAGCAGG - Intronic
1147359460 17:39921938-39921960 AGGGTCAGGTTGGGGAAAGATGG - Intronic
1147535297 17:41316857-41316879 AGGGGTGGGGTGGGAATGGAAGG + Intergenic
1147567705 17:41547855-41547877 TGGGTCTGTGTGGGGAGAGACGG - Intergenic
1147965666 17:44193119-44193141 AGGAGTTGGGTGGGAAGAGAGGG - Exonic
1148466557 17:47868600-47868622 AGGGTCTGGCTGGCATTAGGAGG - Intergenic
1148792880 17:50183522-50183544 AGGGTCTGGGAGGGACCAGGAGG - Exonic
1149575603 17:57709958-57709980 TGTGTCGGGGTGGGACTAGATGG + Intergenic
1150139773 17:62717830-62717852 AGGATCTGGGTGGGAAGAGATGG - Intronic
1151173508 17:72268185-72268207 AGGGTTTAGGTAGGAACAGATGG + Intergenic
1151701055 17:75742763-75742785 TGGGTCTGGGTGGGGAGAGTGGG + Intronic
1151955629 17:77378833-77378855 AGGGTGGGGGTGGGGGTAGATGG - Intronic
1154021310 18:10666186-10666208 AGGGTCTGGGTGGGAGAGGCAGG + Intergenic
1154301456 18:13196298-13196320 AGGGGCTGGGTGAGGATAAAAGG - Intergenic
1155012361 18:21792403-21792425 TGGGGCTGGATGGGAAGAGAAGG - Intronic
1157531458 18:48424358-48424380 ATGGTCTTGGTGGGACAAGAGGG - Intergenic
1157947906 18:52001895-52001917 AGGGCCTGGGTGGTTACAGAAGG + Intergenic
1159415482 18:68142308-68142330 AGGATATGGGTGGGCAAAGAAGG + Intergenic
1160777356 19:862273-862295 TGGGTTAGGGTGGGAATAGGGGG + Intronic
1161312440 19:3602370-3602392 AGGGACTGGGTGGGCAAAGGTGG + Intronic
1161446237 19:4320847-4320869 AGTGTCTGGAGGGGAATAGCTGG + Intronic
1162558178 19:11400429-11400451 AGGGTCAGGGTGGTAAATGAGGG + Intronic
1163090975 19:15020443-15020465 AGGGTCTGGGTGGGGAGGGGAGG - Exonic
1163184748 19:15629506-15629528 AGGGCCTGGCTGGGAAGAGGCGG + Exonic
1163446420 19:17349045-17349067 ATGGGCTGGGAGGGAATTGAGGG + Intergenic
1163586713 19:18168375-18168397 AGGGTCTGGCTGAGGAGAGAGGG - Intronic
1163684729 19:18704938-18704960 AGGGGCTGGGAGGGAATGGAGGG - Intronic
1163887729 19:19982858-19982880 AGGGTCTGCTTGAGAATAGAGGG + Intergenic
1164983703 19:32632722-32632744 AGGGTCTTGGTGGGAAGTCAAGG + Intronic
1165427381 19:35753589-35753611 AGGGGCTGGGCAGGAATGGATGG + Intronic
1165445253 19:35853314-35853336 AGGGTGTGGGCGGGAGTAAAAGG + Intronic
1166218065 19:41349265-41349287 AGAGTCTGTGTGGGAATGCAGGG - Intronic
1166567146 19:43772202-43772224 AGGGGATGGGAGGGTATAGAGGG - Intronic
1166637547 19:44464002-44464024 AGGGACTGGGTTCGAATCGAGGG + Intergenic
1168607245 19:57769905-57769927 AGGGTCTGGGTGGGTAGGGTGGG - Intronic
1168609308 19:57786543-57786565 AGGGTCTGTGTGGGGATGGCGGG - Intronic
925146815 2:1587713-1587735 AGGGACTGGGTGGGGACAGAGGG - Intergenic
925146876 2:1587922-1587944 AGGGACTGGGTGGGGACAGAGGG - Intergenic
925146898 2:1587982-1588004 AGGGACAGGGTGGGGACAGAGGG - Intergenic
925146911 2:1588020-1588042 AGGGACAGGGTGGGGACAGAGGG - Intergenic
925156364 2:1651514-1651536 AGGGCCTGGGAGCGAATATAAGG - Intronic
925639337 2:5972206-5972228 AGCCTCTGGGTGGGAGTGGAGGG - Intergenic
925689904 2:6511233-6511255 AGGGGTGGGGTGGGAAGAGATGG - Intergenic
925773128 2:7303826-7303848 GGGTTCTGGGTGAGAATTGATGG + Intergenic
925815708 2:7746281-7746303 GGAGTCTGAGTGGGAATAGACGG - Intergenic
925853676 2:8108748-8108770 AGGGTCTGGGAGTGGAGAGATGG - Intergenic
926940112 2:18126638-18126660 AGGGTCTGGGTGGGAATAGAGGG + Intronic
927516312 2:23673836-23673858 AGGGTGTGGGTGTGAACATATGG - Intronic
928006435 2:27566397-27566419 AGTTTCTGGGTGGGGATTGAAGG + Intronic
928050666 2:27991545-27991567 TGGATCAGGGTGGGAATATAGGG - Intronic
929869093 2:45743098-45743120 AGGGGCTGGGTGGGGAGTGAGGG + Intronic
930085225 2:47492255-47492277 TAGGTCTGGGGAGGAATAGAAGG + Intronic
930110790 2:47676894-47676916 AGAGTCAGGGTGGGAATGGAGGG - Intergenic
930576085 2:53150514-53150536 AGGGTGTGGGTGGGGAGAGAGGG + Intergenic
931044248 2:58332332-58332354 GTGGTCAGGGTGGGAATATAAGG + Intergenic
931613344 2:64127657-64127679 AAGGTCTTGTTGGTAATAGAGGG - Intronic
931862008 2:66365026-66365048 AGGGTCTGGAAAGGAAGAGAAGG - Intergenic
934576768 2:95406895-95406917 AGGGTCTGGCTGGGAACAGGTGG - Intronic
934638987 2:96015063-96015085 AGGGTCTGGCTGGGAACAGGTGG - Intergenic
934734833 2:96684844-96684866 GGGGGCTGGGTGGGGGTAGAAGG + Intergenic
934771138 2:96908203-96908225 AGAGTGTGGACGGGAATAGACGG + Intronic
934794661 2:97090349-97090371 AGGGTCTGGCTGGGAACAGGTGG + Intronic
935190620 2:100775599-100775621 AGGGACTGTGTGGAAATTGATGG + Intergenic
935541571 2:104354502-104354524 AGGCTCTGGGAGGGAATGGCAGG + Intergenic
935562607 2:104574676-104574698 AGGGTCTCGGGGGAAATAGTTGG + Intergenic
936535365 2:113306894-113306916 ATGGTCTGGTTTGGAATACAAGG - Intergenic
937092913 2:119218358-119218380 AGGGTCTCAGTGGGGATTGAAGG + Intergenic
937239890 2:120453225-120453247 AGGGTGGGGGTGGGAGTGGAGGG - Intergenic
937901099 2:127019775-127019797 TGGCTCTGGGAGGGAAGAGAAGG + Intergenic
939254927 2:139730582-139730604 GTGGTCTGGATGGGAAAAGAGGG - Intergenic
940259942 2:151768967-151768989 AGTGTGGGGGAGGGAATAGAAGG + Intergenic
942247081 2:174017842-174017864 AGGGTCTGGGGGTGCAGAGAGGG + Intergenic
944418997 2:199508651-199508673 ATGGACTGGGTGGCAAGAGATGG + Intergenic
945274083 2:207970623-207970645 AGGGTCTGAGTGGGAATCAAAGG - Intronic
946146899 2:217738055-217738077 AGGGTGGGAGTGGGAATGGAGGG - Intronic
947230550 2:227881405-227881427 AGGGTCTTTTTGGGAATATAGGG + Intronic
947312949 2:228823975-228823997 GGGGTCTGCATGGGAAGAGAGGG + Intergenic
948092199 2:235303729-235303751 AGGGGCTGGGTGAGAACTGATGG + Intergenic
948568238 2:238899865-238899887 TGGGTATGGGTGGGAGCAGAGGG + Intronic
1169266024 20:4167833-4167855 AGGGTCTGGCTGGGAGGAGTTGG + Intronic
1169975301 20:11319087-11319109 AGGGGCTGGGTGGGAGAGGAGGG - Intergenic
1171426503 20:25051878-25051900 TTGGTCTGGGTGGGACTGGAAGG + Intronic
1172945540 20:38685426-38685448 AGGCACTGAGTGGGAAGAGAGGG + Intergenic
1173086558 20:39925004-39925026 AAGGTCTGGGTGGGGGTGGAAGG - Intergenic
1173152492 20:40579565-40579587 AGGGCCTGGTTGGGTGTAGAGGG - Intergenic
1175276645 20:57775169-57775191 AGGGCCTGGGTTGGGACAGAGGG + Intergenic
1175892011 20:62319837-62319859 AGGGTCGGGGTGGCAAGGGAGGG + Intronic
1179049701 21:37878739-37878761 TGGGGCTGGGTGGGGAAAGAGGG + Intronic
1180179766 21:46112720-46112742 CGAGTCTGGGTGGGGATGGAGGG - Intronic
1180874372 22:19168337-19168359 AGGGGATGGGTGTGCATAGATGG - Intergenic
1181822029 22:25483951-25483973 AGGGTCTGGGAAGGAAGGGATGG + Intergenic
1183308897 22:37098617-37098639 AGGGTGTGGGTGGCAGGAGAAGG - Intronic
1183689737 22:39381954-39381976 AGGGGCTGGGTGTGGAGAGAGGG - Exonic
1183714495 22:39525809-39525831 AGGATATGGGTGTGAAGAGAGGG + Intergenic
1185219879 22:49623953-49623975 AGGGTCTGGGTGGCACTTGAGGG - Intronic
949242492 3:1889210-1889232 TTGGTCTGCGTGGGAAAAGATGG - Intergenic
950624181 3:14232290-14232312 AGGGTTTGAGAGGGAAGAGAAGG - Intergenic
951093479 3:18601459-18601481 AGGATATGGGTGGGAAGATAAGG + Intergenic
953406672 3:42663278-42663300 AGGGGCTGGGTGGGAGTGGGAGG - Intronic
953586923 3:44210045-44210067 AGGACCTGGGAGGGAACAGATGG - Intergenic
953619962 3:44524703-44524725 AGGGGATGGGTGGGATTGGAAGG - Intergenic
954924561 3:54220963-54220985 AGGCCTTGGGTGGGAATGGAGGG + Intronic
955992503 3:64642935-64642957 AAGGTCTCAGTGGGAATAGCAGG + Intronic
956623591 3:71245549-71245571 AGGGGGTGGGTGGGTAGAGAAGG - Intronic
958111477 3:89152378-89152400 AGGTTGTGGGTGGAAAGAGAAGG - Intronic
958799919 3:98743697-98743719 AGTGACTGGGTGGGAACACATGG - Intronic
958908425 3:99966903-99966925 AAAGTCTGGGTGAAAATAGATGG + Intronic
959509161 3:107190161-107190183 AGAGTGTTGGTGGAAATAGATGG - Intergenic
960593501 3:119387790-119387812 ATGGTCTGGTTGGGAAGACAAGG + Intronic
960942400 3:122943398-122943420 AGGGTCGGGGTGGGAAGTGCAGG - Intronic
961574262 3:127822432-127822454 AGGGTCTGGGTGCGGGAAGAGGG - Exonic
961615116 3:128173139-128173161 AGGGTCTGGGTAGGAAAAGAAGG + Intronic
962173271 3:133125394-133125416 AGGGTCTGAGTGGAAATAAGTGG + Intronic
962340320 3:134576784-134576806 GGGGTCTGGGAGACAATAGAGGG + Intergenic
962839118 3:139217757-139217779 AGGGTGAGGGTGGGAAGAGGAGG - Intronic
962921341 3:139953245-139953267 AGGATCTGTGTGGGCATAGAGGG - Intronic
964412477 3:156413172-156413194 AGGGTCTGAGTGGGGATAGAAGG + Intronic
964862547 3:161218698-161218720 AGGTTGTGGATAGGAATAGACGG + Intronic
965680010 3:171240546-171240568 GGGGACTGGGGGGGAATAGTAGG - Intronic
966259114 3:177954014-177954036 AGTGTATGGGAGGGAATAAAGGG + Intergenic
967205198 3:187113109-187113131 AGGGTGAAGGTGGGAATGGATGG + Intergenic
967945749 3:194802397-194802419 AGGATCTGGGTGAGGATGGAGGG - Intergenic
968043912 3:195612770-195612792 AGGGAATGGGAGGGAATAGGAGG - Intergenic
969049656 4:4363641-4363663 AGGGGCTGGGAGGGGACAGAGGG + Intronic
969703647 4:8780904-8780926 AGGGTCAGGCTGGTAATGGATGG - Intergenic
970429497 4:15975651-15975673 AGGGTCTGGGTGGAAAAGAAAGG + Intronic
970915879 4:21334261-21334283 AGGGTCATGGGGGGAATAAAAGG + Intronic
972148831 4:36064333-36064355 TGGGTGTGGCTGGGAATAGGAGG - Intronic
972265569 4:37455712-37455734 AGGGTCTGGGTGGGACGTCAAGG - Intronic
973845159 4:54904246-54904268 AGTGATTGGGTGGGAAAAGAAGG + Intergenic
973977369 4:56275917-56275939 CGGCACTGGGTGGGAATTGAAGG + Intronic
980577819 4:134708316-134708338 ATGGTGGGGGTGGGAATAGGGGG - Intergenic
981523828 4:145692817-145692839 AGGGACTGGGTGGGAAGTGCAGG - Intronic
981837166 4:149067459-149067481 AGGGAGAGGGGGGGAATAGAGGG + Intergenic
981919259 4:150068583-150068605 AGGGTCTGAGTGGGATGTGAGGG + Intergenic
982744502 4:159092769-159092791 AGGGCCTGGCAGGGAATAGGAGG + Intergenic
983643211 4:169963047-169963069 GGGGGGTGGGTGGGAATAAAAGG + Intergenic
985424315 4:189813373-189813395 AGAGCCTGGGTGGGAAAGGAGGG + Intergenic
986074265 5:4318493-4318515 GGGGTCTGGCTGGGAAATGATGG - Intergenic
986208512 5:5648418-5648440 AGGGCCTGGGTGGGAAAGTAGGG - Intergenic
986474116 5:8108098-8108120 AGGACCTGGGAGGGAATGGAAGG + Intergenic
986684035 5:10260092-10260114 AGGGTCAGGGAAGGAAGAGAGGG + Intronic
987001087 5:13660755-13660777 AGTGTCTGGTTGGGAATAAAAGG - Intergenic
987804055 5:22739709-22739731 AGGGGCTGGGAGGAAATGGAGGG - Intronic
988852788 5:35195883-35195905 TGGGTTTGGCTGGGAGTAGAAGG + Intronic
989098816 5:37805998-37806020 AAGGACTGGGTGGAAAAAGAAGG + Intergenic
990561698 5:56990129-56990151 AGAGTCTGGGAGAGAAGAGATGG - Intergenic
991726530 5:69541204-69541226 TGGGTGTGGGTGGGTATTGATGG - Intronic
991868427 5:71086670-71086692 TGGGTGTGGGTGGGTATTGATGG + Intergenic
992503586 5:77364735-77364757 AGGGTCTGGGGAGGAAGAAAAGG + Intronic
995057223 5:107773268-107773290 ATGGTATGGGTGGGACTAAAGGG + Intergenic
997211430 5:132079292-132079314 AGGGTGTGGGTGGGTATTGGGGG + Intergenic
997586968 5:135049015-135049037 AGGGTGTGGGTGGCTAAAGAGGG - Intronic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
999175483 5:149628943-149628965 TGGTTCATGGTGGGAATAGAGGG - Exonic
1000108310 5:158082187-158082209 AGAGTCTGAGTGGGCATAGTTGG + Intergenic
1000687602 5:164272207-164272229 AGGGTCTAGCAGGAAATAGATGG + Intergenic
1000872182 5:166590728-166590750 AGGATCTGGGTGGAGAAAGAGGG - Intergenic
1001318200 5:170659364-170659386 AAGGCATGGGTGGGAGTAGAGGG + Intronic
1001649007 5:173302123-173302145 AGGGTCTGGGTGGGATTTGGTGG + Intergenic
1001722052 5:173864871-173864893 AGGGGCTGGGAGGAAACAGATGG - Intergenic
1001809185 5:174614149-174614171 AGGGTCTGGGTGGCAGCAGGTGG - Intergenic
1002058512 5:176612271-176612293 AGGGACTGGCTGGGAAAAGGAGG + Intergenic
1002830761 6:818425-818447 AGGGCCTGGCTGGGAAAAGGTGG - Intergenic
1004596813 6:17106975-17106997 AGAGGCTGGATTGGAATAGATGG + Intronic
1004729373 6:18342793-18342815 AGAATGAGGGTGGGAATAGAGGG + Intergenic
1004984594 6:21066959-21066981 AGGAACTGGGTGTGAATGGAGGG - Intronic
1005979336 6:30824424-30824446 AGGGACTGAGTGGGGACAGATGG + Intergenic
1006003913 6:30987735-30987757 AGGAAATGGGTGTGAATAGAAGG + Intronic
1006300423 6:33191064-33191086 AGGGGCTGAGTGGGTAGAGATGG - Intronic
1006421130 6:33934953-33934975 AGTGTCTGGCTGGGATTTGAAGG - Intergenic
1006520007 6:34565869-34565891 AGGGGCTGGCTGGGATTTGAAGG - Intergenic
1006740428 6:36304133-36304155 ATGGTCTGGGTGGAGACAGAGGG + Intronic
1007397307 6:41585259-41585281 AGGGTCTGGGTGCGGAGGGAGGG - Intronic
1009004011 6:57759307-57759329 AAGCTGTTGGTGGGAATAGATGG - Intergenic
1011000791 6:82586036-82586058 ATGGTCTGAGTGGGAAAGGATGG - Intergenic
1011227202 6:85120401-85120423 TGGGTCTGGGTGGGAAGAGGAGG - Intergenic
1012320465 6:97838517-97838539 AGGGTCTTGGGGGGAAGAGTGGG + Intergenic
1012542315 6:100375478-100375500 AGAGTCTGGGTGGCAATGGGGGG + Intergenic
1013455047 6:110322911-110322933 AGGAACTGGGTGGGAGGAGAAGG + Intronic
1013664354 6:112331742-112331764 TGGGGATGGGAGGGAATAGAAGG - Intergenic
1015521922 6:134140115-134140137 AGGGCCTGTGTGAGATTAGAAGG + Intergenic
1015684552 6:135845259-135845281 AGGGTCTGGGGGAAAATTGAAGG - Intergenic
1018560054 6:165092816-165092838 AGGGTTTGGGTGGGAGGAAAAGG + Intergenic
1021231044 7:18086716-18086738 CGGGGCTGGGTGGGGATAGGAGG - Intergenic
1022260430 7:28699034-28699056 AGGGACTGGGTGGGAAGCCATGG + Intronic
1022399444 7:30023486-30023508 AGGGTCTGAGTGGGGATTTAGGG - Intronic
1023638894 7:42238264-42238286 AGAGGCTGGGTGGGAGAAGATGG - Intergenic
1023902643 7:44494993-44495015 AGGGTCTGCGTGTGAAAAAAAGG + Intergenic
1029241016 7:99162534-99162556 ATGGTCTGGGTGCAAAGAGATGG - Intergenic
1029618882 7:101677672-101677694 AGGATCTGGGAGGGAACACAGGG - Intergenic
1030068662 7:105679766-105679788 AGGGGCAGGCTGGGAAAAGAAGG + Intronic
1032539249 7:132689713-132689735 AGAGCCAGGGTGGGAAGAGAAGG + Intronic
1032900113 7:136297637-136297659 AGAGTATGGGTGGGAATCAAAGG + Intergenic
1033911435 7:146268309-146268331 AGGGTCAGGGTTTCAATAGAGGG - Intronic
1035096500 7:156360253-156360275 AGGGTGTGGGAGGAAAGAGAGGG + Intergenic
1037181715 8:16014858-16014880 AGTGTCTGAGTGGACATAGAGGG + Intergenic
1037583723 8:20262095-20262117 AAGTTCTGGGGGGGAATGGATGG - Intronic
1038075848 8:24072653-24072675 TGGGATTGGGTGGGAATAGAGGG + Intergenic
1038350436 8:26771469-26771491 AGGGTTTGGGTAGGTAGAGAAGG - Intronic
1038687999 8:29736256-29736278 AGGGTCTTGGTGAGAATTCAGGG - Intergenic
1038884321 8:31646855-31646877 AGGCTCTGGATGGGAAGAGAAGG - Intronic
1039227516 8:35404349-35404371 AGGGTTTGAGAAGGAATAGAAGG + Intronic
1039576432 8:38627455-38627477 AGGGTTGGGGTGGGAGCAGATGG + Intergenic
1040917505 8:52578428-52578450 AGGGAATGGGTGGGAATATAAGG - Intergenic
1041253841 8:55961870-55961892 AGGGTGTGGGTGGGAGGGGATGG - Intronic
1041368624 8:57135378-57135400 AGAGTTTGGGTGGGAAAAGAAGG - Intergenic
1042426630 8:68656724-68656746 AGGGACTGGGTTGGAGTAAAGGG - Intronic
1044876326 8:96670872-96670894 TGGGTGGGGGTGGGAGTAGAGGG + Intronic
1044881935 8:96731973-96731995 AATGTCTGGGTGGGAAGAGGAGG - Intronic
1045112289 8:98947402-98947424 AGGGGTTGGGTGGGAAGGGAAGG + Intronic
1047026475 8:120829923-120829945 TGGGTCAGGGAGGGAATTGAGGG - Intergenic
1047228980 8:122979927-122979949 AGGTTCTTAGGGGGAATAGAGGG + Intergenic
1047702387 8:127462073-127462095 GGGGGCTGGGTGGGGATAGGAGG + Intergenic
1048280404 8:133101515-133101537 AGGGGCTGGGTGGGTATCAAAGG - Intronic
1048375897 8:133822206-133822228 AGGGTCTGGGGTGGAGTTGATGG + Intergenic
1049106435 8:140616681-140616703 AGGGCCTGGGTGGGAGTCCAGGG + Intronic
1049411576 8:142475965-142475987 TGGGGCTGGGTGGGACTAGTTGG + Intronic
1053419660 9:37969477-37969499 AGGGTCTTGGTGAGATTTGATGG - Intronic
1053833953 9:42114007-42114029 AGGGTCTGAATGAGAATATAAGG + Intronic
1054596596 9:67073402-67073424 AGGGTCTGAATGAGAATATAAGG - Intergenic
1055056668 9:72030237-72030259 AGGGAGTGGGAGGGAATAGGTGG + Intergenic
1055426708 9:76204194-76204216 ACGGTCATGGTGGGGATAGAGGG - Intronic
1057725251 9:97563895-97563917 AGGGGCTGGGTGGGGGTAGGGGG - Intronic
1058614997 9:106816774-106816796 AGGCTCTGGGTTGGAAGAAATGG - Intergenic
1058800560 9:108541018-108541040 ATGGGGTGGGTGGGAATAAAGGG + Intergenic
1061227834 9:129291029-129291051 CGGGTCTGGGTGGGAGTAGGTGG - Intergenic
1061382615 9:130267309-130267331 AGGCTCTCGGTGGGCATAGGCGG - Intergenic
1061798726 9:133102993-133103015 AAGGCCTGGATGGGAGTAGAGGG - Intronic
1185511774 X:669134-669156 AGGGCCTGTGGGGGGATAGAAGG - Intergenic
1187236431 X:17471904-17471926 AGGGCCAGGGAGGGAATTGATGG + Intronic
1189484660 X:41420968-41420990 AGGGACTGGGTGGGATTTGATGG + Intergenic
1190132157 X:47758451-47758473 AGGGTCTTGGTGGGGATAGCTGG + Intergenic
1191783748 X:64895422-64895444 AGGATCTAGGTGGGAATATATGG - Intergenic
1194686317 X:96922150-96922172 AGGGTCACAGTGTGAATAGAAGG + Intronic
1196811831 X:119635067-119635089 AAGGGCTGGGAGGGAATGGAGGG + Intronic
1198183992 X:134236746-134236768 AGGGTGTGCGTGGGGATGGAGGG + Intergenic
1200769756 Y:7112874-7112896 AGGCTCAGGGTGAGAAGAGATGG + Intergenic