ID: 926946087

View in Genome Browser
Species Human (GRCh38)
Location 2:18188932-18188954
Sequence TTTTTATATTCACAAAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 366}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926946087 Original CRISPR TTTTTATATTCACAAAACCC AGG Intronic
902093961 1:13927180-13927202 TACTTCTATTAACAAAACCCAGG - Intergenic
902943244 1:19815306-19815328 TATTTATTTTCTCAAAACCTAGG + Intergenic
903113269 1:21156615-21156637 ATTTTCTAGTCTCAAAACCCTGG + Intronic
904872887 1:33632603-33632625 GTTTTATTCTCACAAAAACCAGG - Intronic
905046004 1:35002366-35002388 TTTTTATATTCCTAAAACCTTGG + Intronic
906796302 1:48698766-48698788 ATTTCATTTTCACAACACCCTGG + Intronic
906806352 1:48782461-48782483 TTTAAAAATTTACAAAACCCAGG - Intronic
907999283 1:59665011-59665033 GTTTTGAATTCAAAAAACCCAGG - Intronic
908690738 1:66776768-66776790 TTTCTATTTTTACAAACCCCAGG + Intronic
909004598 1:70260186-70260208 TTCTTATACTCACAAAAATCAGG + Intergenic
909092292 1:71241579-71241601 ATTTTAAATTCAAAAAACCATGG + Intergenic
909224467 1:72999860-72999882 TATATATATACACAAAACCAAGG + Intergenic
909225404 1:73014504-73014526 TATTTTTATTCTCAAAACCAGGG + Intergenic
909400054 1:75217827-75217849 TTATTATCTTCACAAAAGTCAGG + Intronic
909492077 1:76237157-76237179 TTTTTATATTCTCCCCACCCAGG + Intronic
909508047 1:76417360-76417382 GTTTTATATTCAAAACAACCTGG + Intronic
910025172 1:82641669-82641691 TTTTTAGATTCAAAAAACGGAGG + Intergenic
911382656 1:97135226-97135248 TTGTATTTTTCACAAAACCCCGG + Intronic
911427749 1:97741669-97741691 CTTTTATATTCTCATATCCCAGG - Intronic
912003781 1:104868001-104868023 TTTTCATATTCAACAGACCCAGG + Intergenic
912090144 1:106062478-106062500 TTTTTTTTTGGACAAAACCCTGG + Intergenic
912200293 1:107449752-107449774 TTTTTCTATTAACTAAATCCAGG + Intronic
915495063 1:156276433-156276455 TTTTTAAATGCATAAAACACAGG + Intronic
916243851 1:162667157-162667179 TGTTTGTAATCACAAAACACTGG - Intronic
917030251 1:170682513-170682535 TTGTTATACTAACAAATCCCAGG - Intronic
917955110 1:180088152-180088174 TCTTTATATTCATAAAACATTGG + Intronic
919949245 1:202347448-202347470 TTTTTATATTCACCAAGACTGGG - Intergenic
921498233 1:215867239-215867261 TTTTTTTCTTCACAAAATACAGG + Intronic
922345194 1:224690681-224690703 TTTTTATATTCACAAATGTCAGG - Intronic
922995388 1:229953876-229953898 TTTTTCTATTCCCAAAACTGAGG - Intergenic
924164359 1:241266341-241266363 TTTTGAAAATCACAAAAACCTGG - Intronic
1063358367 10:5424501-5424523 TTTTTTTCTTGAGAAAACCCTGG - Intronic
1064934283 10:20662664-20662686 TTCTTATATTCTCAAAAAGCAGG - Intergenic
1065787795 10:29232316-29232338 TTTTTAAATTCTCAAAGACCAGG + Intergenic
1066539104 10:36425244-36425266 TTTTTATATTCATAAAATCTTGG + Intergenic
1068154272 10:53176682-53176704 TTTTTATAGTCACCAAAGCCTGG + Intergenic
1068474436 10:57507237-57507259 TTTTTATGTTCTCAAAACGGAGG - Intergenic
1068690349 10:59907070-59907092 GTTTTATATTCTCAAAAGCAAGG + Intergenic
1070166106 10:73899221-73899243 TGTTCATATTCCCAGAACCCAGG + Intergenic
1070441195 10:76445192-76445214 CTTTATTATTCACAAAATCCAGG - Intronic
1070735773 10:78862683-78862705 TTTTTATGTTCTCAATATCCTGG - Intergenic
1071801075 10:89061019-89061041 TTTTTATTTTCACATCACACAGG + Intergenic
1072593458 10:96848914-96848936 ATTTTATATGCACAAAAACAAGG - Intronic
1072622945 10:97092394-97092416 TTCTCATATTCACAAATCCTTGG - Intronic
1072829875 10:98646326-98646348 TTTTTTTTTTAAAAAAACCCTGG + Intronic
1072909627 10:99488339-99488361 TTTTGATTTTCACAAGCCCCAGG - Intergenic
1074411018 10:113228718-113228740 TTTCTCTTTTCACAAAACCCTGG - Intergenic
1076025523 10:127108921-127108943 TCTTTGTATTCAAAAAGCCCGGG - Intronic
1078574120 11:12484122-12484144 TATTTACATTCACAACACCTAGG + Intronic
1078903453 11:15662794-15662816 TCTTTTAATTCAAAAAACCCTGG - Intergenic
1079385220 11:19972810-19972832 TTTTTATGTCCCCAACACCCAGG + Intronic
1079639099 11:22781819-22781841 TTTTTATAAGCACAAGACCCAGG - Intronic
1080146431 11:28990265-28990287 TCTTAATATTCACATATCCCAGG - Intergenic
1080902869 11:36511928-36511950 ATTTTATACTGACAAAAGCCTGG - Intronic
1080908998 11:36576112-36576134 CAATTATTTTCACAAAACCCTGG + Exonic
1081411424 11:42762885-42762907 ATTGTATATTCTCTAAACCCAGG + Intergenic
1083804394 11:65065586-65065608 TTTTTAAAATCCCATAACCCGGG - Intergenic
1085060686 11:73443760-73443782 TTTTTAAAATATCAAAACCCAGG - Intronic
1085845818 11:80063507-80063529 ATTTGATGTTCACAAAAGCCAGG + Intergenic
1087431133 11:98056813-98056835 TTTCTGTATTCACAAAACTGTGG - Intergenic
1087487438 11:98773622-98773644 TTTTCAAATTCAAAAGACCCAGG + Intergenic
1088167204 11:106952938-106952960 ATTTTATATTTAGAAAACCCTGG - Intronic
1088170886 11:106995300-106995322 TTTTCACATTCATAAAACCGGGG - Intronic
1088657243 11:112012176-112012198 TGTTTATATCTACAAAAGCCTGG - Intronic
1088739112 11:112752297-112752319 GCTTTATGTTCCCAAAACCCAGG + Intergenic
1089047214 11:115512509-115512531 ATTTGATATCCACAGAACCCAGG + Intergenic
1090017524 11:123099471-123099493 TTCTAATATTTACAAAACCCTGG - Intronic
1092007491 12:5081543-5081565 TTTTAACATTAATAAAACCCTGG - Intergenic
1092029207 12:5269832-5269854 TTTGTATTTTCAGTAAACCCGGG + Intergenic
1092857408 12:12687591-12687613 TTTTTAAATTCAGACAACGCAGG - Intronic
1092973929 12:13725755-13725777 GGTTTCTCTTCACAAAACCCTGG - Intronic
1093055489 12:14551757-14551779 TATTTATATTCACACAACTTTGG + Intronic
1095482789 12:42652984-42653006 TTTTTTTAATCACCAGACCCTGG - Intergenic
1095777870 12:46029252-46029274 TTTTAAAATTCACAAAACTATGG + Intergenic
1095935987 12:47681967-47681989 TTTTTATTCTCACCAAATCCTGG + Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1098523903 12:71464798-71464820 TTTTTATGTTCAGAAAACAGGGG + Intronic
1098607395 12:72408334-72408356 GTTTAATAATCACAAAAGCCAGG - Intronic
1099301207 12:80896792-80896814 TTTATATAATGACAAAATCCTGG + Intronic
1099861956 12:88232698-88232720 TTTTCATATCCACCAAGCCCAGG + Intergenic
1100188638 12:92165400-92165422 TTATTCTATTCACAAAACTTGGG - Intergenic
1100545191 12:95595220-95595242 TTTTTTTATTCCCCCAACCCTGG - Intergenic
1101532152 12:105583138-105583160 ATTTGATATTCACAACAACCTGG - Intergenic
1101683137 12:106988401-106988423 TTTTTATATTCGGATAACTCAGG - Intergenic
1102890234 12:116552970-116552992 TTTCTATATTTAAGAAACCCAGG + Intergenic
1103820672 12:123695596-123695618 TTTTTTTAATCACACAACACAGG + Intronic
1104267569 12:127249649-127249671 TATTTAAAATCACAAAAACCTGG + Intergenic
1106625336 13:31415163-31415185 TTTTTATATTCATAGCACCATGG - Intergenic
1106683570 13:32032933-32032955 TTCTTATATAAACAAAACCTGGG + Intronic
1107019472 13:35736658-35736680 TATTTATATTCATAAAACATTGG + Intergenic
1107194644 13:37634975-37634997 TTTTAATTTTCAGAAAAGCCAGG - Intergenic
1108560524 13:51639062-51639084 TTTTTATTGTCACAAAATCAAGG + Intronic
1108898942 13:55373643-55373665 TGTATATATTCACATAATCCTGG - Intergenic
1109356869 13:61241888-61241910 ATATTATATTCACAAAATCAGGG + Intergenic
1110281863 13:73703230-73703252 ATTTTATATTTACAAAATTCAGG + Intronic
1110507423 13:76303795-76303817 TTTTTATAGCAACAAAACCTTGG - Intergenic
1110591131 13:77260706-77260728 TGTTTATTTTCACAAAGGCCTGG + Intronic
1110783685 13:79497505-79497527 TTTTAATATTCAGAATGCCCAGG + Intronic
1111189400 13:84788990-84789012 TTTTTCTATTAATCAAACCCTGG - Intergenic
1111469980 13:88667819-88667841 TTTTTATATCTACAAAATTCAGG - Intergenic
1112569494 13:100580856-100580878 TGTGTATATTCATAAAAACCGGG + Intronic
1112789358 13:102986599-102986621 TTTTAATATTGAGAAAACCTTGG + Intergenic
1113265661 13:108614855-108614877 TTTTTAAATTCTTAAAACACAGG + Intronic
1114045058 14:18867877-18867899 TTTTTTAATGCACAAAGCCCAGG + Intergenic
1114119153 14:19651591-19651613 TTTTTTAATGCACAAAGCCCAGG - Intergenic
1114803052 14:25800164-25800186 GTTTTATTTTCACAAATCCTTGG + Intergenic
1115175585 14:30558654-30558676 TTTTTGTTTTCCCTAAACCCAGG + Intergenic
1115403823 14:32993617-32993639 TTTTTATATTCAAATAACTAAGG + Intronic
1115433249 14:33345623-33345645 TTCTTGTGTTCACAAAATCCGGG + Intronic
1115683014 14:35762966-35762988 TTATTTTATTAACAAAACCTAGG + Intronic
1116033442 14:39600505-39600527 ATTTTATATATAGAAAACCCTGG + Intergenic
1117645469 14:57847117-57847139 TTTTTACATTTCCAAAACTCTGG - Intronic
1120399974 14:84018550-84018572 ATTTTCATTTCACAAAACCCAGG - Intergenic
1123191186 14:106573178-106573200 TATTTATATGCACCAAACACTGG - Intergenic
1124148231 15:27151398-27151420 TATTGATATTCACAATAACCTGG - Intronic
1124620922 15:31273484-31273506 GCTTCATCTTCACAAAACCCTGG + Intergenic
1126449864 15:48794667-48794689 TTTTTATATGCAGAAAGACCAGG + Intronic
1126620414 15:50633955-50633977 TTTTCATGTTCATAAAACACAGG + Intronic
1127836031 15:62791949-62791971 CTTTTATAATCACACAACCCAGG + Intronic
1127841025 15:62832056-62832078 TTTTTACAGTGAGAAAACCCAGG - Intronic
1128444691 15:67748224-67748246 TTTTCAGATTCAGAAAAACCAGG + Exonic
1129009665 15:72404052-72404074 TTTTAATATTCAAAACACCAAGG - Intronic
1130322268 15:82851018-82851040 ATTTTCTATTCACAAAAAGCTGG - Intronic
1131775890 15:95798238-95798260 TTATTATAGTCTCAAATCCCTGG + Intergenic
1132397783 15:101487614-101487636 ATTTTAGAATCCCAAAACCCAGG + Intronic
1133009570 16:2903553-2903575 TTTTTATTTTCAGAAAATCAAGG + Intergenic
1133773937 16:8883653-8883675 TGTTTAAATTCCCAAAACCCAGG - Intergenic
1134572466 16:15303085-15303107 TATTTATTTTTACAAAACCAAGG - Intergenic
1134729916 16:16452955-16452977 TATTTATTTTTACAAAACCAAGG + Intergenic
1134937516 16:18258941-18258963 TATTTATTTTTACAAAACCAAGG - Intergenic
1135894900 16:26390613-26390635 TTTTTATTCTGACAAAATCCAGG - Intergenic
1136040537 16:27575391-27575413 ATTTTATATTCTCATAAGCCTGG - Intronic
1137759728 16:50930692-50930714 TCTACATTTTCACAAAACCCTGG + Intergenic
1139060740 16:63248256-63248278 TTATTATAGTCACAAAACTATGG + Intergenic
1140216836 16:73015584-73015606 TTTATCAATTCACAAAAGCCAGG + Intronic
1141962179 16:87416455-87416477 TTTTAAGATTCACAAATCCTTGG + Intronic
1143066705 17:4255141-4255163 TTTCTAGATTCACATCACCCTGG + Intronic
1143421180 17:6793767-6793789 ATTTTATCTTCACAACATCCTGG + Intronic
1144154840 17:12489426-12489448 TTTTTATGTACAGAAAGCCCAGG - Intergenic
1145950232 17:28811543-28811565 TTCTTATATTCACAGACCCTCGG - Intronic
1147736721 17:42643370-42643392 TTTATGTATTCAAAAAACACCGG - Intergenic
1148397622 17:47323233-47323255 TTTTTGAATTCCCACAACCCTGG + Intronic
1148690802 17:49525719-49525741 TTTTTAGAGTCACACAATCCTGG + Intergenic
1151781958 17:76252687-76252709 TTTTTTTTTTCACTATACCCGGG + Intergenic
1153150791 18:2090356-2090378 TATTTAAAATCAAAAAACCCAGG - Intergenic
1153353756 18:4111404-4111426 TTTTGATATTAGCAAAACGCTGG + Intronic
1153730499 18:8006627-8006649 ATCTTATATTCCCAAAACCATGG + Intronic
1154988021 18:21572293-21572315 ATTTTATATGCATAGAACCCTGG - Intronic
1155494108 18:26426065-26426087 ATCTTATTTTCACAGAACCCAGG - Intergenic
1155833066 18:30542651-30542673 TTTATATACTATCAAAACCCAGG + Intergenic
1155895262 18:31317212-31317234 TATTTATTTTCACAAACCTCAGG + Intergenic
1156013784 18:32524930-32524952 TTTATGTCTTCACAAAAACCTGG + Intergenic
1157050110 18:44153572-44153594 TTTTAATTTTCACTAAGCCCTGG + Intergenic
1158734103 18:60060331-60060353 TATTTATATCCACAAAGCACAGG + Intergenic
1158800883 18:60907296-60907318 TATTTATATTCACCAAAAACTGG + Intergenic
1159070891 18:63622871-63622893 TCTATAAATCCACAAAACCCGGG - Intergenic
1159472557 18:68876742-68876764 GGTTTATATTGACAAAACTCAGG + Intronic
1159596454 18:70387187-70387209 TTCTGAATTTCACAAAACCCTGG - Intergenic
1159690148 18:71477449-71477471 ATTTTATATTTAGAAAACCCCGG + Intergenic
1160045925 18:75387292-75387314 TTGTTATAATCACACAAGCCTGG - Intergenic
1160295718 18:77634863-77634885 TCTTTCTTATCACAAAACCCAGG + Intergenic
1160411735 18:78679675-78679697 TTTTCCTCTTCACAAAACCCAGG - Intergenic
1161671911 19:5617325-5617347 ATTTTGTGGTCACAAAACCCAGG - Intronic
1162435750 19:10657127-10657149 TTTTTATCTTAACAAAGTCCTGG + Intronic
1164685011 19:30160822-30160844 TTTTTATTTCCCCAAGACCCTGG + Intergenic
1164859109 19:31548486-31548508 TTTTTCAATTCTCAACACCCAGG + Intergenic
1167764474 19:51471829-51471851 ATATTATATTCACCAAAACCTGG - Intergenic
1167807581 19:51799237-51799259 TTTTAGTATTCACAGACCCCGGG - Intronic
926597868 2:14810707-14810729 TTTTAATCCTCACAAAGCCCTGG - Intergenic
926856863 2:17266192-17266214 TCTTTATACTCACCAAAACCAGG - Intergenic
926946087 2:18188932-18188954 TTTTTATATTCACAAAACCCAGG + Intronic
929073896 2:38061421-38061443 TTTTTATGGTCACAAAATCAGGG - Intronic
929177129 2:38991253-38991275 TTCTTAAACTCACAAAAGCCTGG + Intronic
929310108 2:40413792-40413814 TTTTTATATTTACTAATCCTTGG + Intronic
929354253 2:41000660-41000682 TTTTTGTATTCTTAGAACCCTGG + Intergenic
929455239 2:42060581-42060603 TTTTTCTGTTCACTACACCCGGG - Intergenic
930403140 2:50917166-50917188 TTTGTATATGCACCAAACACAGG + Intronic
933066151 2:77800033-77800055 TTTGTATATGCACAAAAACCTGG - Intergenic
933948191 2:87306286-87306308 TATTGATACACACAAAACCCTGG + Intergenic
933986710 2:87597699-87597721 TTTTTATATACAGAAAAACATGG - Intergenic
934668643 2:96192569-96192591 TTTTTAAATACACAAAACAAAGG + Intronic
935534230 2:104274212-104274234 TTTTTATATGCACAGAGCCTGGG - Intergenic
936307133 2:111353110-111353132 TTTTTATATACAGAAAAACATGG + Intergenic
936332011 2:111555309-111555331 TATTGATACACACAAAACCCTGG - Intergenic
937472017 2:122182220-122182242 TTTTTATATTAAACAAACACAGG + Intergenic
937679480 2:124628190-124628212 TATTCAAATTCAGAAAACCCAGG + Intronic
937819711 2:126295888-126295910 TATTTATAATCACCAAAACCTGG + Intergenic
938008344 2:127807761-127807783 TTTTTGTATTCCTAAAACCTAGG - Intronic
939491825 2:142885502-142885524 CTTTTATATTCCCAAAATACAGG + Exonic
939594616 2:144108337-144108359 ATTGTATATTTAGAAAACCCCGG + Intronic
939835897 2:147129367-147129389 TTTTTATATTAAGAAAACAAAGG - Intergenic
940212128 2:151265537-151265559 TACTTATTTTCATAAAACCCTGG + Intergenic
940564580 2:155344809-155344831 TTTGTACATTCAAAAAATCCTGG + Intergenic
941104479 2:161336884-161336906 TTTTTATATTCTTAATACACTGG + Intronic
941106101 2:161354903-161354925 TTTTTATATTCTCAAAATACTGG + Intronic
941107885 2:161380349-161380371 TTTTTAGATTCATGAAACACTGG - Intronic
941376233 2:164734548-164734570 TTTTTGTATTCAAAATAGCCTGG + Intronic
941638477 2:167961781-167961803 TTTTAACATTCCCAAAGCCCAGG + Intronic
942150097 2:173067572-173067594 TTGTTATAATCAGAAAATCCTGG - Intergenic
942923804 2:181409452-181409474 TTTGAATACTTACAAAACCCAGG - Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
945786772 2:214249289-214249311 TTTTTATGTTCACAAAAATCTGG - Intronic
1169862053 20:10163293-10163315 ATTGTATATTTAGAAAACCCTGG + Intergenic
1173245814 20:41336689-41336711 ATTGGATTTTCACAAAACCCAGG - Intergenic
1173938026 20:46885126-46885148 TAATTCTATTCACAAACCCCAGG - Intergenic
1174101106 20:48126824-48126846 CTTTTATATTCACACAAGTCAGG + Intergenic
1174121290 20:48267706-48267728 CTTTTCTTTTCTCAAAACCCTGG - Intergenic
1174309367 20:49639033-49639055 TTTTTAAAATCACAAATCTCAGG - Intronic
1174904469 20:54536106-54536128 TTTTTATATTCTAAAGACCAAGG + Intronic
1177336917 21:19740996-19741018 TTTTAATATTCACAAATCATTGG + Intergenic
1177790505 21:25717621-25717643 TATTGTTATTCATAAAACCCAGG + Intronic
1177966449 21:27733806-27733828 TTTTTGTATTGCCAAAACCAGGG + Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1180463588 22:15590491-15590513 TTTTTTAATGCACAAAGCCCAGG + Intergenic
1181575243 22:23790049-23790071 ATTTTATATTCAGGAAACCTGGG + Intronic
1183527923 22:38335021-38335043 ATTTAATCTTCACAACACCCTGG + Intronic
1184881970 22:47312196-47312218 TTTTAATATTCAAAAAATCAAGG - Intergenic
949464475 3:4329855-4329877 TTTATATATTCACAAAATTATGG - Intronic
949472335 3:4409383-4409405 TTTTTCTTTTCACCAATCCCAGG - Intronic
952781421 3:37103476-37103498 TTTTTATATTCCCAAAGACCAGG + Intronic
955263322 3:57416854-57416876 AGTTTATGTTCACAAAACTCTGG + Intronic
957204080 3:77172135-77172157 TTTTGATGTTAAGAAAACCCTGG - Intronic
957239973 3:77646732-77646754 TTTTACTATTGACAAAAGCCGGG + Exonic
957266136 3:77968764-77968786 TGTTTATAATCACAAAATACTGG + Intergenic
960211511 3:114972948-114972970 TATTTTTATTCACAAAATCAAGG - Intronic
960649746 3:119933703-119933725 TTTTTATTTTCACAAGAGACGGG - Intronic
960917256 3:122708640-122708662 TTTTTATATTCAAGAAGCCTCGG - Intronic
961269202 3:125675646-125675668 TTTTTATGTTCACAACAACTTGG - Intergenic
962052659 3:131834129-131834151 TTTTTTTAAACACAAAAGCCAGG + Intronic
964056614 3:152468634-152468656 TTTTTATAATGGCAAAATCCTGG + Intergenic
967267223 3:187701413-187701435 TTTTTATATTTACAAAATGAGGG - Intronic
967370700 3:188742574-188742596 ATTATATATTTACAAAATCCTGG + Intronic
967627849 3:191707204-191707226 TTTTTATATCGACAAAATACTGG - Intergenic
969591686 4:8125939-8125961 TTTTTTGGTTCACAACACCCTGG + Intronic
970934892 4:21557824-21557846 TTTCTATAGTTACAAAGCCCAGG - Intronic
971153731 4:24060880-24060902 ATTTAATCTTAACAAAACCCTGG + Intergenic
971907427 4:32745244-32745266 TTTTTATATTGACAAATTACAGG - Intergenic
971984062 4:33796350-33796372 TTCTAAGGTTCACAAAACCCTGG + Intergenic
972206605 4:36780862-36780884 TTTCTATGTTCATAAAACCATGG - Intergenic
972845648 4:42986013-42986035 TATTTACATTCTCAAATCCCTGG - Intronic
975001480 4:69227865-69227887 CTTTAATTTTCACAATACCCAGG - Intergenic
975012323 4:69372810-69372832 CTTTTATTTTCACAATCCCCAGG + Intronic
975028409 4:69581588-69581610 TTTTTATCTTATAAAAACCCAGG - Intergenic
975697062 4:77023945-77023967 TTATTATATTCTCAAAGCACAGG + Intronic
976059848 4:81114310-81114332 TTTTTTTTTTCACCAAACACAGG - Intronic
976728694 4:88241340-88241362 TCCTCATATTTACAAAACCCTGG - Intergenic
977833948 4:101626598-101626620 TTTTTATAAGCTCAAAAACCAGG + Intronic
978041118 4:104063660-104063682 TTTTTGCCTTTACAAAACCCTGG - Intergenic
978114056 4:104998150-104998172 AGTCTATATTTACAAAACCCTGG - Intergenic
978351132 4:107822131-107822153 TTTTCAAATTTACAAAGCCCAGG - Intergenic
978912935 4:114086444-114086466 TTTTTATTTTTAAAGAACCCAGG - Intergenic
978984348 4:114991535-114991557 ATTGTATATTCAGAAAAACCTGG + Intronic
980341581 4:131555452-131555474 TATTTCTATTCACAAAATCCAGG - Intergenic
981093959 4:140759675-140759697 TTTTAATCTTCACAAAAGCAGGG - Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
981559386 4:146030322-146030344 TTTTCATATTCTCAAAAAACAGG + Intergenic
983139415 4:164130626-164130648 ATATTATCTTCACAACACCCTGG + Intronic
983412183 4:167415300-167415322 ATTTTATATTCAAAAAAGACTGG - Intergenic
984427700 4:179608889-179608911 TTTGTATTTTTACAAAACACAGG - Intergenic
984867718 4:184296488-184296510 TGTTTATTTTCACATAACCATGG - Intergenic
986102411 5:4626222-4626244 TTTTCATATTCACAAAAACTGGG + Intergenic
986752428 5:10800871-10800893 TTGGTATATTCACAAAAGGCAGG + Intergenic
986844284 5:11734642-11734664 TTTTAATATTTACACAACCCTGG - Intronic
987608244 5:20167301-20167323 ATTTTAAATTCACAACCCCCAGG + Intronic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
988271150 5:29018687-29018709 TTTTTTTTTTCAGAAAACCTAGG + Intergenic
988553696 5:32218861-32218883 TTTTTAGATTCGCAAAGCCTGGG - Intergenic
988970555 5:36463335-36463357 TTTTTAAACTCACAATACCAAGG + Intergenic
989513275 5:42313252-42313274 ATTTTATAGTCACAATACCATGG + Intergenic
989549071 5:42711406-42711428 CTGTTATATTGACAAAAGCCAGG - Intronic
989955570 5:50355079-50355101 TTGTTATATACACAGATCCCAGG - Intergenic
990033100 5:51285510-51285532 TATTTATATTCAGAACACCATGG + Intergenic
993314432 5:86382727-86382749 TTTATTTATTCAGAAAACACAGG + Intergenic
993804671 5:92390114-92390136 ATCTTACATTCACAATACCCTGG + Intergenic
994767277 5:103934813-103934835 TATTTATCTTGACAAATCCCTGG + Intergenic
995013857 5:107288274-107288296 TTTTTATTTTCTAAAAAACCTGG - Intergenic
995365003 5:111348960-111348982 TTATTGTATTGAAAAAACCCTGG + Intronic
995463047 5:112422213-112422235 TATTTATATTCACAACAGCATGG - Intergenic
998362143 5:141597727-141597749 TTTTAAAATTCACAACACCTGGG + Intronic
998419431 5:141969785-141969807 TTTTTAAAATCTCAATACCCAGG - Intronic
999334334 5:150702376-150702398 TATTTATATTCACTAAAATCTGG - Intergenic
1000327192 5:160181263-160181285 TTTTTCTATTCACAAAACAGAGG - Intergenic
1000871273 5:166580332-166580354 AATTTATATTAGCAAAACCCTGG - Intergenic
1001456514 5:171865411-171865433 TTTTTATAATCACTAAAAACTGG + Intronic
1001893963 5:175362856-175362878 TTTTTAAAATCCCAATACCCAGG - Intergenic
1002082958 5:176748376-176748398 TCTTGACATTCACAAAACTCAGG + Intergenic
1002405862 5:179030599-179030621 TTTTTATATGCAGAAAATTCTGG + Intronic
1002761753 6:207923-207945 TTTTTATATTTAAAAATACCTGG - Intergenic
1004478902 6:16000304-16000326 TTTTTATGCTCACTTAACCCAGG - Intergenic
1004892611 6:20115978-20116000 TTTTTCTAATGAGAAAACCCAGG - Intronic
1005455889 6:26019501-26019523 TTTTTAAATTCACAAGAGACAGG - Intergenic
1007992078 6:46267086-46267108 TTTTTAATTTCATAAAACCAAGG + Intronic
1008214620 6:48772503-48772525 TTTTTATATGAACAAAATGCAGG + Intergenic
1009389724 6:63131149-63131171 TTTTTACATTCAGAAAACTAAGG + Intergenic
1009393091 6:63166064-63166086 TTTTTATATTTATAAATCCCTGG + Intergenic
1009737605 6:67697536-67697558 TTTTTATAATTACAAAAACTTGG + Intergenic
1010638981 6:78299124-78299146 ATTTAATATTCATAAAAGCCTGG + Intergenic
1011645275 6:89451750-89451772 TTTTTAGATGCACAAAAACATGG - Intronic
1011648107 6:89479507-89479529 TATTTATAATAACAAAACACTGG - Intronic
1012487561 6:99739088-99739110 TTTTTAAATTCTCAAAAACTTGG - Intergenic
1012496652 6:99841063-99841085 TTTTTATATGCACACAAACTTGG - Intergenic
1012798115 6:103789722-103789744 TTTCTAGATTCACAAAACTATGG + Intergenic
1014595748 6:123335909-123335931 TTTTGATTTTCACAAAATCAAGG + Intronic
1014834267 6:126142523-126142545 AATTTATAGTCAGAAAACCCAGG + Intergenic
1015129939 6:129797626-129797648 TTTTTATTTTCAGAGAAACCTGG + Intergenic
1015405291 6:132829721-132829743 TATTCCTATTCACAAAAACCTGG + Intergenic
1015411645 6:132900184-132900206 TTTTTATAATTTCAAAAACCTGG - Intergenic
1019811645 7:3169324-3169346 TTTTTATACTCACAGATTCCAGG - Intronic
1019991906 7:4697661-4697683 TATTCATATTCCCAAAACCCAGG - Intronic
1020225114 7:6273364-6273386 TTTTTAAATTAACAAAATGCAGG + Intergenic
1020400188 7:7768148-7768170 TTTTTATATGCCCAATACCCTGG + Intronic
1020666576 7:11051528-11051550 TTTTTATAAATACAAAATCCAGG - Intronic
1021086361 7:16424717-16424739 TTTTTAAATTCACAAGACAAAGG - Intergenic
1021261974 7:18469714-18469736 TTTTTATTTTCACAATAACTAGG - Intronic
1021614770 7:22490602-22490624 TTTGTATATGCACAACACCTAGG + Intronic
1022150930 7:27605465-27605487 TTTTTTTTTTTACAAGACCCAGG + Intronic
1022508150 7:30919472-30919494 TACTTGCATTCACAAAACCCAGG + Intronic
1023240061 7:38134271-38134293 TTTTTAAAATCACAACAACCAGG + Intergenic
1024160128 7:46665236-46665258 TTTTTAAATTCCCAAAAAACAGG - Intergenic
1024476893 7:49821976-49821998 TTTTTATATTCATAAAAAGATGG - Intronic
1024728293 7:52225698-52225720 TTTTTATATGAGCAAAATCCGGG - Intergenic
1024772134 7:52735931-52735953 TTTTTCTGTTCACAAAACAGAGG - Intergenic
1026230701 7:68481042-68481064 TTTTTCTAACCAAAAAACCCTGG - Intergenic
1027656939 7:80942268-80942290 TTTTCATCTTCACCAAACACTGG + Intergenic
1028060266 7:86304634-86304656 TCCTTATATTCACTAAACACAGG + Intergenic
1028323264 7:89489390-89489412 TTCTTCTCTTCACTAAACCCAGG + Intergenic
1028379604 7:90184453-90184475 TTTGTATATGCACAACACCTAGG - Intronic
1028395657 7:90365674-90365696 ATTGTATATTTAGAAAACCCCGG - Intronic
1028514693 7:91664130-91664152 TTTTTATATTCACAGAGCCCAGG + Intergenic
1028635300 7:92982096-92982118 TATTTATAATCACAAAACACTGG - Intergenic
1030937429 7:115602421-115602443 TTTTTCTATTCACCAAGCACTGG - Intergenic
1030978612 7:116158536-116158558 TTTTTATTTTCTCAAAATTCTGG + Intronic
1031593236 7:123619229-123619251 TCTTTATATCCACACTACCCAGG - Intronic
1032287270 7:130549254-130549276 TTTTTATATTTACAATGCCTAGG + Intronic
1032979036 7:137260600-137260622 TTTTTACTTTTACAAAGCCCAGG + Intronic
1033075710 7:138248265-138248287 TTTTAATATTAAGAAAACTCAGG - Intergenic
1034804572 7:154077998-154078020 TTATTTCTTTCACAAAACCCTGG + Intronic
1035967953 8:4215482-4215504 TCTATGTATTCATAAAACCCCGG - Intronic
1036106532 8:5846534-5846556 TTTATATATTCACAAAGACATGG - Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1036801872 8:11798577-11798599 GTTTTGTAATCACAAAATCCAGG - Intronic
1037653385 8:20861620-20861642 TTTTTATATTTACAGAGCTCTGG + Intergenic
1038443548 8:27587633-27587655 TTTTTATATTAACACAATACGGG - Intergenic
1038761671 8:30390225-30390247 TCGTGATATTCACAAAACCGAGG + Intronic
1042272360 8:66967486-66967508 TATTTTTAGTCACAAAACTCTGG - Intronic
1042693112 8:71525840-71525862 TTTTTCTGTTTACAAAACCTTGG + Intronic
1043736796 8:83758237-83758259 TTTTTTTGTTCATAAAATCCTGG + Intergenic
1044303869 8:90616141-90616163 TTTTTGTATTCACAAAGATCTGG + Intergenic
1044894949 8:96881664-96881686 GTTTAATATTCACAAGATCCTGG - Intronic
1046141062 8:110092869-110092891 GTTTTATATTCAAGAAACCAAGG - Intergenic
1046171012 8:110506116-110506138 TTTTAGTATTTACCAAACCCTGG - Intergenic
1046882919 8:119330392-119330414 CATTTCTCTTCACAAAACCCAGG + Intergenic
1046934358 8:119872409-119872431 ACTTTATCCTCACAAAACCCTGG - Intergenic
1047626508 8:126662011-126662033 TTTTAATATACACAAAACAGTGG + Intergenic
1049031243 8:140039437-140039459 TTTTTAAAATCACACAATCCAGG - Intronic
1050818125 9:9840896-9840918 TTTTTATATTCAGCAGATCCTGG + Intronic
1051439463 9:17068764-17068786 TTTTTATGTTCCCCAAACTCTGG - Intergenic
1051568833 9:18531989-18532011 ATTTAATATTCTCAAAAACCCGG - Intronic
1052344272 9:27392712-27392734 TTTTTATCTTTCCAAAACACTGG - Intronic
1052617652 9:30862838-30862860 ATTTTACATTCAAAAGACCCGGG - Intergenic
1054892290 9:70264017-70264039 TTTTAATAATTACAAAACACTGG - Intronic
1054902579 9:70385173-70385195 TTTTTATATTAAAAAGACCATGG - Exonic
1055255852 9:74370144-74370166 CTTTTAGATTCACAAAATTCAGG + Intergenic
1055394329 9:75857813-75857835 TTTTTATAGTGACAAAACTGAGG - Intergenic
1057547784 9:96030979-96031001 CTTTTATACTCACAGACCCCTGG - Intergenic
1058293672 9:103277490-103277512 TATTTATTTTCAGAAAACACTGG - Intergenic
1059128925 9:111723846-111723868 TGTTCATATTAATAAAACCCTGG - Exonic
1060114754 9:120931055-120931077 TTTCTAACTTCACAACACCCAGG - Intergenic
1060410586 9:123397480-123397502 TTTTTATATTAATGAAAACCTGG + Intronic
1060911461 9:127354468-127354490 TTTTTATTTTCAGTAAAACCTGG - Intronic
1061284904 9:129616654-129616676 ATTTGATACTCACCAAACCCAGG - Intronic
1062163545 9:135093458-135093480 ATTTGATCTTTACAAAACCCCGG - Intronic
1187607040 X:20896343-20896365 TTTTTAAAATCCCAAAGCCCAGG + Intergenic
1189263625 X:39696372-39696394 CTTTTCTATTTACAAAACACAGG + Intergenic
1190926080 X:54906169-54906191 ATGTTATATTCACTAAACCTAGG + Intergenic
1191998292 X:67120703-67120725 TATTTTTATTCACAAAACTTTGG + Intergenic
1192630461 X:72773930-72773952 TTTTTATATTTAAAGAAGCCTGG - Intergenic
1192651249 X:72946874-72946896 TTTTTATATTTAAAGAAGCCTGG + Intergenic
1192819785 X:74632658-74632680 TTTTTATTTTTACAGAACCAAGG - Intergenic
1193130735 X:77916910-77916932 TTTTTAAATTCCGAATACCCTGG - Intronic
1193554481 X:82935250-82935272 TTGATATACTCAGAAAACCCTGG - Intergenic
1194337338 X:92664767-92664789 TTTTCATATTCATAAAACACAGG + Intergenic
1194866214 X:99071196-99071218 TTATGAAATTCACAAACCCCCGG + Intergenic
1196338727 X:114570231-114570253 TCTTTAAATTTACAAAACACAGG - Intergenic
1196819041 X:119688406-119688428 TTTTTATTTTGAAAAATCCCAGG + Intronic
1197007608 X:121521444-121521466 TTTTTATATGCCCAGCACCCAGG + Intergenic
1197177825 X:123503715-123503737 TTTTAATAATTACAAACCCCTGG - Intergenic
1199155554 X:144543420-144543442 TTTTAATGATTACAAAACCCTGG + Intergenic
1199272511 X:145900499-145900521 TTTTTATATTCACAACAATTGGG - Intergenic
1199273818 X:145919229-145919251 TTTGTATACACACAAAAACCTGG + Intergenic
1199555546 X:149104281-149104303 TATTTATAATCACCAAAACCTGG - Intergenic
1200040343 X:153361108-153361130 TGTTTCTATTAGCAAAACCCTGG - Intergenic
1200645763 Y:5781501-5781523 TTTTCATATTCATAAAACACAGG + Intergenic