ID: 926954621

View in Genome Browser
Species Human (GRCh38)
Location 2:18280949-18280971
Sequence CTGGACCAAAAAAGGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 411}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926954614_926954621 27 Left 926954614 2:18280899-18280921 CCAGCTGTAACTGCTAATATTCC 0: 1
1: 0
2: 0
3: 2
4: 199
Right 926954621 2:18280949-18280971 CTGGACCAAAAAAGGGAGAAAGG 0: 1
1: 0
2: 2
3: 25
4: 411
926954615_926954621 6 Left 926954615 2:18280920-18280942 CCAATAATGTTATTGAGACTCCC 0: 1
1: 0
2: 1
3: 4
4: 82
Right 926954621 2:18280949-18280971 CTGGACCAAAAAAGGGAGAAAGG 0: 1
1: 0
2: 2
3: 25
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926954621 Original CRISPR CTGGACCAAAAAAGGGAGAA AGG Intronic
900248095 1:1648774-1648796 CTGTCTCAAAAAAAGGAGAAGGG - Intronic
900259314 1:1715931-1715953 CTGTCTCAAAAAAAGGAGAAGGG - Intronic
901611796 1:10504587-10504609 CTGGGCCAACACAGAGAGAAAGG - Intronic
902326524 1:15704373-15704395 CTGACCCAAAATAGGCAGAATGG + Intronic
902667502 1:17949813-17949835 TTGGACCAAAAGAGGCAGACTGG + Intergenic
902754182 1:18538187-18538209 CTGGAGCAGAGAAGGGAGAGGGG - Intergenic
902765379 1:18611083-18611105 CTGGTCCAGAAAAGGGAGATTGG - Intergenic
903054647 1:20627121-20627143 CTGGACCATAAAAGGCAGGGTGG + Intergenic
903080002 1:20802681-20802703 TTGGACCAGAAAAGGGACATTGG + Intergenic
903606082 1:24576151-24576173 CTGGACCAAGAAAGGCAGGTCGG - Intronic
903712018 1:25333136-25333158 TTGGAACAAAAACGGAAGAAAGG - Intronic
904242517 1:29157753-29157775 ATGGCCAAAAAAAGCGAGAAGGG + Intronic
904867715 1:33594689-33594711 CTCAACCCAAATAGGGAGAAGGG - Intronic
905757060 1:40519569-40519591 CTGCAAAAAAAAAGAGAGAATGG + Intergenic
907441254 1:54479903-54479925 GGAGACCAAGAAAGGGAGAAAGG - Intergenic
907617986 1:55944220-55944242 CTGTAGCCAAAAATGGAGAAAGG + Intergenic
909280813 1:73750569-73750591 CTGGACATAAAAGGGAAGAAGGG + Intergenic
910323930 1:85981814-85981836 CTGGGCTAAAAATTGGAGAAAGG + Intronic
910344874 1:86225110-86225132 CTGGCCCAAATTAGAGAGAAAGG - Intergenic
910629885 1:89343637-89343659 CTGGACCTATAGAGGGAGAGAGG - Intergenic
911004339 1:93202620-93202642 CTGATCCAAGAAAGGTAGAAAGG + Intronic
911630212 1:100174995-100175017 CAGGAGCAAAAGAGGGAGCAGGG - Intronic
912079134 1:105913217-105913239 CTGGACTTATAGAGGGAGAAAGG - Intergenic
912321633 1:108719363-108719385 CTGAACCCAGAAAGGGACAAGGG - Intronic
913200196 1:116489745-116489767 ATGGGCCAGGAAAGGGAGAAGGG + Intergenic
914263431 1:146018829-146018851 CTGGAACATAAATAGGAGAAGGG - Intronic
914334521 1:146702254-146702276 CTGACCAAAGAAAGGGAGAATGG + Intergenic
914840394 1:151243471-151243493 CTGTACATAAAAGGGGAGAATGG + Intronic
915130560 1:153692976-153692998 CTGGCCCAAAAGAGGGAGAGAGG + Intronic
915160942 1:153920321-153920343 CTGGCAAAAAAAGGGGAGAAGGG + Intronic
915357764 1:155266441-155266463 CTTTCCCAAGAAAGGGAGAAAGG + Intronic
916048661 1:161019725-161019747 CTGGATCAAAGAATGGAAAAAGG + Intronic
916698749 1:167268467-167268489 GTGGAGCACAAAAGGGGGAAAGG + Intronic
919089652 1:192962590-192962612 CTGCTCCAAAAATTGGAGAAGGG + Intergenic
920251917 1:204627635-204627657 CTGCACCAAAAAAGGCTGCAGGG + Intronic
920347352 1:205314894-205314916 AGGTTCCAAAAAAGGGAGAAAGG + Intronic
920526415 1:206670079-206670101 TTCAACCAAAAAAGGCAGAAAGG - Intronic
922432138 1:225565742-225565764 CTGGACTACAAATGGGACAAAGG + Intronic
922538903 1:226404218-226404240 ATGGAACAAAAAAGGAAGGATGG + Intronic
923218041 1:231868201-231868223 CTGACCTAAAAAGGGGAGAACGG - Intronic
1063995590 10:11615504-11615526 CTGAACCAAGGAATGGAGAAGGG - Intergenic
1064764974 10:18661284-18661306 ATGTAACAGAAAAGGGAGAAAGG - Intronic
1064799724 10:19055664-19055686 CAGGAACACACAAGGGAGAAAGG - Intronic
1065436055 10:25704897-25704919 CAGGAACAAGAAAGAGAGAAGGG - Intergenic
1065743515 10:28817906-28817928 CTGAAATTAAAAAGGGAGAAGGG - Intergenic
1067956487 10:50796652-50796674 TGGGAAGAAAAAAGGGAGAAAGG - Intronic
1068639317 10:59384621-59384643 GTGGACTAAGAATGGGAGAAGGG + Intergenic
1070913201 10:80136021-80136043 CTGGACCCAAACAGTAAGAAAGG - Intronic
1071042485 10:81330316-81330338 ATGGAGGAAAAGAGGGAGAAGGG + Intergenic
1071862411 10:89687657-89687679 CTGGAACAGAAAAGGGACACTGG - Intergenic
1072914691 10:99530717-99530739 CTGGAAAAAGAAAAGGAGAAAGG - Intergenic
1073729834 10:106274347-106274369 CTGGGCCTATAGAGGGAGAAAGG - Intergenic
1074251761 10:111757716-111757738 CTGGAGCAAAAAAGTGACCAAGG - Intergenic
1075211103 10:120491721-120491743 CTTCACCAAAAAAGGGAGAGAGG - Intronic
1076458203 10:130619033-130619055 ATGGAACAGGAAAGGGAGAATGG - Intergenic
1078750963 11:14163449-14163471 CTGGAGAAATAAAAGGAGAATGG - Intronic
1078910281 11:15724623-15724645 GAGGAGCAGAAAAGGGAGAAGGG + Intergenic
1079230601 11:18645777-18645799 CTCGACCAAAAAAGGGAACTGGG - Intergenic
1079758198 11:24293317-24293339 ATGGAATAAAAAAGGGAGTATGG - Intergenic
1080914965 11:36648070-36648092 CTGGGCCACAAAAGGGATACAGG - Exonic
1082988390 11:59186801-59186823 CTGGGCCAAGAAAAGAAGAATGG - Intronic
1084021864 11:66422563-66422585 TTGGACCGAGGAAGGGAGAAGGG - Intronic
1084181396 11:67448355-67448377 CTGCCCAGAAAAAGGGAGAAGGG + Intergenic
1084711735 11:70847845-70847867 CTGGACCAAAGAGGGGGGCAGGG + Intronic
1085437024 11:76515140-76515162 CATTACCCAAAAAGGGAGAACGG - Intronic
1085783186 11:79428014-79428036 CTGGACCTAAGAAGACAGAAGGG + Intronic
1086010199 11:82093641-82093663 CTGGTCCATAGAAGGCAGAAGGG - Intergenic
1086218785 11:84416102-84416124 CTGGAGCACAAAATGGAGAAGGG - Intronic
1086496862 11:87412907-87412929 CTGTTCCAAAAAATTGAGAAGGG + Intergenic
1089643454 11:119863004-119863026 CTGGACCAAATCAGAGAGATGGG + Intergenic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1091790084 12:3267127-3267149 CTTTCCCAAAACAGGGAGAATGG + Intronic
1091830274 12:3544364-3544386 CTTGGCCAAAAAAGCGACAAAGG + Intronic
1092010110 12:5102641-5102663 CAGGACCAAGCCAGGGAGAAAGG + Intergenic
1092336216 12:7636295-7636317 CTGGATCCAGAAAGGAAGAAAGG + Intergenic
1096862513 12:54540032-54540054 CTGCACCAGAACAGGGTGAAGGG - Intronic
1096996510 12:55841583-55841605 CTCTACCAAAAAAGAAAGAAAGG - Intronic
1098037927 12:66325278-66325300 CTGGAGCAAAAAAGAGCAAAAGG - Intronic
1098784637 12:74736149-74736171 CAGGAACAAAAAAGAGAGGATGG - Intergenic
1100899748 12:99224503-99224525 CAGGACCAAGAGAGAGAGAAGGG - Intronic
1101483479 12:105127106-105127128 CTGAAACAGAAAAGGGAAAAGGG - Intronic
1101568386 12:105931141-105931163 CTGGAGCAGCAAAGGGATAAAGG + Intergenic
1104282140 12:127387939-127387961 CAGGACCACAAAAGGGTGAGAGG - Intergenic
1105475959 13:20728441-20728463 CAGGACCAAAAAATGGAGCTGGG - Intergenic
1105687604 13:22801002-22801024 CTTGATCAAAAAAGGGGCAAAGG - Intergenic
1106430950 13:29680095-29680117 CTGGAGCAAAAAAGGGCATACGG - Intergenic
1106443714 13:29803610-29803632 CAGAAAAAAAAAAGGGAGAAGGG + Intronic
1106857998 13:33873685-33873707 ATGGAGCAAAAGAGGGTGAAGGG - Intronic
1109467855 13:62762170-62762192 CTGTTCCAAAAAACTGAGAAGGG + Intergenic
1109487262 13:63042575-63042597 ATGCACCAAATAAAGGAGAATGG + Intergenic
1110249225 13:73363155-73363177 CTGGAACAAAAAAAGGACATTGG + Intergenic
1110548288 13:76781590-76781612 CTGGACCAAAACAGATAGATAGG - Intergenic
1110675138 13:78233622-78233644 GGGGACTAAAAAAGGAAGAAAGG - Intergenic
1111674855 13:91374797-91374819 ATGGAGGAAGAAAGGGAGAATGG + Intergenic
1113062502 13:106338311-106338333 CAGGAGCAAGAAAGGGAGCAGGG - Intergenic
1113923700 13:113928851-113928873 CTGGACCAAACCAAGGAGCACGG - Intergenic
1114940671 14:27606603-27606625 CTGAACTCCAAAAGGGAGAAGGG - Intergenic
1115054433 14:29105578-29105600 CTGGAATAATAAGGGGAGAAGGG - Intergenic
1115299828 14:31871814-31871836 CTGGAAGAAAAAAAGGTGAATGG + Intergenic
1115311240 14:31980490-31980512 CTATACCAAAAAATGGAGAAGGG - Intergenic
1115794073 14:36912971-36912993 CTGGGAAAAAAAAAGGAGAAAGG - Intronic
1116043117 14:39710046-39710068 CTGGAGTTAAAAATGGAGAAAGG - Intergenic
1116922104 14:50589572-50589594 CTGGACCAGAAAAGGAAGAATGG + Intronic
1117042170 14:51777382-51777404 CTGGACCAAGAAAGGTAGTGCGG + Intergenic
1117173398 14:53123761-53123783 CTGGATTAAAAACCGGAGAATGG + Intronic
1118312764 14:64705390-64705412 TTGGAACACAAAAGGAAGAACGG + Intronic
1118902534 14:69998843-69998865 CTGGAAAAAAACAGGGACAAAGG - Intronic
1119597801 14:75952306-75952328 CTGCACCAAAAAAAAGAAAAAGG + Intronic
1120649633 14:87116603-87116625 CTTGACCAAAATAGGAAGACAGG - Intergenic
1121165119 14:91788375-91788397 CTGAAAAATAAAAGGGAGAATGG + Intronic
1121329791 14:93042676-93042698 GTGGGCAAAGAAAGGGAGAAGGG + Intronic
1124001896 15:25767087-25767109 CTAGACCAGAACAGGCAGAAGGG - Intronic
1124428138 15:29580620-29580642 CTGAACCAAAATAGGAGGAAAGG + Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125711306 15:41789069-41789091 CTGGAACAAAAAGGGGAGTGTGG - Intronic
1125863006 15:43015189-43015211 GTGGAACAGAAAAGGGGGAAAGG + Intronic
1126119572 15:45239775-45239797 CTTGACCATACCAGGGAGAAGGG + Intergenic
1126538569 15:49796243-49796265 CTGGAACAAAAACTGGAGAAAGG - Intergenic
1128930092 15:71696642-71696664 ATAGATCAAAAAAGGGAGAAAGG + Intronic
1130194143 15:81763219-81763241 GTGGACAGAAAAAGAGAGAAAGG - Intergenic
1130685764 15:86035961-86035983 CTTCAGGAAAAAAGGGAGAAGGG + Intergenic
1130783122 15:87066108-87066130 CTAGAACAAAAAAGGCAGACAGG + Intergenic
1130794359 15:87193228-87193250 CTGGACCAGCAAAGAGACAAAGG - Intergenic
1133306580 16:4813381-4813403 CTGGCCCAAATAAGGGAGTGGGG - Intronic
1133938266 16:10285903-10285925 CTCAACCAAAAAAGGGAGCTGGG - Intergenic
1134321531 16:13168568-13168590 CTACACCATGAAAGGGAGAAGGG + Intronic
1134600427 16:15529348-15529370 CTAGGCTAAGAAAGGGAGAATGG + Intronic
1135076517 16:19398850-19398872 CTTGACCAAACTGGGGAGAAGGG + Intergenic
1136108462 16:28048971-28048993 CTGGAGAAAAAAAGGGAGAAGGG + Intronic
1136700123 16:32128488-32128510 CTGGGACAAATAAGGAAGAAAGG - Intergenic
1138329667 16:56203549-56203571 CTGGAGGACAAAAGAGAGAATGG + Intronic
1138914284 16:61444079-61444101 CTGGAACAAAAAAAGGAAATTGG + Intergenic
1139999101 16:71008978-71009000 CTGACCAAAGAAAGGGAGAATGG - Intronic
1140036752 16:71377069-71377091 CAGGAGCAAAAAAGGGGGTAAGG + Intronic
1140341157 16:74164168-74164190 CTGAACCAAAAAAGATAAAATGG + Intergenic
1140476877 16:75243408-75243430 CTGGACCAACACAAGGAGAGCGG + Intronic
1141140408 16:81493394-81493416 CTGGACCATAAAATGCAGATGGG + Intronic
1141289672 16:82706154-82706176 AGGGAGCGAAAAAGGGAGAAGGG - Intronic
1142207875 16:88792556-88792578 TGGGAGCAACAAAGGGAGAAAGG + Intergenic
1143195999 17:5076952-5076974 ATGGACCAATCAAGGGGGAAAGG - Intergenic
1144471326 17:15544430-15544452 TTGGAACAAACAAGAGAGAAAGG + Intronic
1144809961 17:17992742-17992764 CTGGGGAGAAAAAGGGAGAAAGG - Intronic
1144925142 17:18800263-18800285 TTGGAACAAACAAGAGAGAAAGG - Intronic
1145355541 17:22144474-22144496 ATGCACCAAATAAAGGAGAATGG - Intergenic
1146288027 17:31587607-31587629 CTGGACCAGACAATGGACAATGG - Intergenic
1146618804 17:34379849-34379871 GTGGACCAAATTATGGAGAATGG - Intergenic
1147057802 17:37847463-37847485 CTGAACAGAAAAAGGGAGAGAGG + Intergenic
1150370226 17:64631194-64631216 CAGGTCAAAAAAAGGGAGAGAGG + Intronic
1150507351 17:65712962-65712984 CTGGACATAAAAAGTAAGAATGG + Intronic
1150858168 17:68773230-68773252 TTGGGCCAAAAATGGTAGAAAGG + Intergenic
1152105193 17:78324612-78324634 CTGGAACTGAAAAAGGAGAAGGG - Intergenic
1152905025 17:82965298-82965320 CTGGGACAACAGAGGGAGAAGGG - Intronic
1203178107 17_KI270729v1_random:34730-34752 ATGGACCGAAAAAGATAGAATGG + Intergenic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1155839210 18:30626766-30626788 CTGGTCCTATAGAGGGAGAAAGG + Intergenic
1156125875 18:33904473-33904495 CTAAACCATAAAAGGGAGGAGGG - Intronic
1156590142 18:38478351-38478373 CTGGAAGAAAACAGGGAAAAAGG - Intergenic
1156744506 18:40372490-40372512 CTGGCCCAGGAAAGGGAGAATGG - Intergenic
1157564492 18:48670646-48670668 CTGGACCAGAAAAGACAGAAAGG - Intronic
1157743081 18:50110364-50110386 CTGGAGCAAATGAGGGAGGAAGG - Intronic
1159790436 18:72772547-72772569 CTAGTCCAAAAAAGGAAGAATGG + Intronic
1160094055 18:75854496-75854518 TTTGACCAAAAAAGGCAGCAGGG + Intergenic
1160208612 18:76858363-76858385 ATTGTTCAAAAAAGGGAGAAGGG - Intronic
1161943783 19:7421914-7421936 CTGGAAGAAGGAAGGGAGAAGGG - Intronic
1162914402 19:13866166-13866188 CTGGCCATAAAAAGGGAAAATGG + Intronic
1165024281 19:32948388-32948410 AAGGAGCAAAAAAGTGAGAAAGG + Intronic
1165398256 19:35579814-35579836 CTGTTCCAAAATATGGAGAAAGG + Intergenic
1165793875 19:38507425-38507447 CGGGACCAAAGAGGAGAGAAGGG + Intronic
1166353291 19:42211371-42211393 CTAGACCCTCAAAGGGAGAAGGG + Intronic
1166963772 19:46515446-46515468 CTGGATGAAACCAGGGAGAAGGG - Intronic
1167213031 19:48145472-48145494 CTGTACCAAAATGGGGACAAGGG + Intronic
1167430195 19:49449746-49449768 GTGGAACAAAAAAGGGGGACAGG - Intronic
1167753484 19:51395002-51395024 CTGGACCTAAAAGAGGAGAAAGG - Intergenic
1168724543 19:58573496-58573518 CTAGACCGCAAAATGGAGAAAGG + Exonic
925247898 2:2401045-2401067 CTGGACCACAAGAGGGAGGGAGG - Intergenic
925657531 2:6165860-6165882 ATTGGCCAAAAAAGGCAGAAAGG - Intergenic
926190933 2:10727072-10727094 CTGTCTCAAAAAAGGGAGGAAGG - Intronic
926765051 2:16316975-16316997 CAGGACAAAAATAGGCAGAAGGG + Intergenic
926954621 2:18280949-18280971 CTGGACCAAAAAAGGGAGAAAGG + Intronic
926963978 2:18389686-18389708 ATTGGGCAAAAAAGGGAGAAAGG - Intergenic
927054951 2:19358863-19358885 CTGGACCTAAAAAGGCAGCAGGG - Intergenic
927226611 2:20772095-20772117 ATGGGCCCAAAAAGAGAGAAAGG + Intronic
927612676 2:24557551-24557573 ATCTACCAAAAAAGGGGGAAGGG - Intronic
928148960 2:28809575-28809597 CTGGCCTATAAATGGGAGAATGG - Intronic
929432950 2:41903727-41903749 CTGGATAAAAGAAGGAAGAATGG + Intergenic
929465843 2:42143081-42143103 GTGGCCCAAGAAAGGGAGGACGG - Intergenic
929560608 2:42954194-42954216 CTGTACCAAAAAAGGGAGGGGGG - Intergenic
929917878 2:46151326-46151348 CTGGACAGAGAAAGGGAGAAGGG - Intronic
932092333 2:68817568-68817590 CTGGACTAGAAAAGGTAAAATGG - Intronic
932330169 2:70894273-70894295 CTGGGCCAGAATAGGGAGAGAGG - Intergenic
932489802 2:72113514-72113536 CTGGGCCAAGAAAGGGAGGTGGG + Intergenic
932708161 2:74042921-74042943 TCGGACCAAAAAGAGGAGAAAGG - Intronic
933796589 2:85924860-85924882 ATTTAGCAAAAAAGGGAGAAAGG - Intergenic
934107689 2:88710793-88710815 CTGGTGCAGACAAGGGAGAAGGG - Intronic
935038834 2:99405784-99405806 TTTAACCAAGAAAGGGAGAACGG - Intronic
935426627 2:102925722-102925744 CTGGGGAAAAAAAAGGAGAAAGG + Intergenic
935438657 2:103065647-103065669 CTGGACTTGAAAAGGCAGAATGG - Intergenic
937055856 2:118936198-118936220 ATGAAGCAAAAAAGGGATAAGGG + Intergenic
937859743 2:126698305-126698327 CTGGGCCCAATGAGGGAGAAAGG - Intergenic
937880184 2:126858819-126858841 CTGGAGGAAAGCAGGGAGAATGG - Intergenic
938775024 2:134534059-134534081 CTGGACCTAAAGAAGGAGATGGG - Intronic
939106329 2:137952791-137952813 CAGGACTAAAAAAGGAAAAAAGG - Intergenic
941090156 2:161165983-161166005 CTGGAGAAAAAAAGGAAGTAAGG + Intronic
942294109 2:174500914-174500936 CTTGGCCAGAAAGGGGAGAATGG - Intergenic
943757284 2:191569752-191569774 CTGCAACAAAACAGGGAGACAGG + Intergenic
943876515 2:193073326-193073348 CTGGGGCAAAAAAGCAAGAAGGG - Intergenic
946561869 2:220922922-220922944 GGGGACCAAAAAGGGAAGAAGGG + Intergenic
946983452 2:225245443-225245465 ATGGACCAAAAATAGGAGTAGGG - Intergenic
946986624 2:225280970-225280992 AAGGACCACAGAAGGGAGAAAGG - Intergenic
947514544 2:230790582-230790604 CAGAAACAAAACAGGGAGAAAGG - Intronic
948592088 2:239057017-239057039 CGGGACCCTAAAATGGAGAAAGG + Intronic
948859713 2:240746905-240746927 CTGGTCCAGAGAAGGGAGACAGG + Intronic
1169427717 20:5509699-5509721 CAGGACCAAAACAAGGAAAAAGG + Intergenic
1170379911 20:15747055-15747077 ATGGACCATAAACAGGAGAATGG + Intronic
1170600439 20:17837446-17837468 CGGAAACAAAAAAGGGAGGAAGG - Intergenic
1170956966 20:20990329-20990351 CTAGAACCAAAAATGGAGAAAGG - Intergenic
1172257620 20:33533424-33533446 CCAGACCTAAAAAGGAAGAAAGG - Intronic
1174708249 20:52678822-52678844 AAGGACCTAAAAAGGGAGGAGGG - Intergenic
1174902027 20:54510223-54510245 CTTAACCAAGGAAGGGAGAAAGG - Intronic
1174990356 20:55502335-55502357 CTGGTTGAAAAAAAGGAGAAAGG + Intergenic
1175031391 20:55958084-55958106 CAGGACCAAAAAAGAGAGACTGG + Intergenic
1175209907 20:57347422-57347444 CTAGAAACAAAAAGGGAGAACGG - Intergenic
1177568306 21:22852456-22852478 ATGGAACAAAAACTGGAGAAAGG - Intergenic
1177969181 21:27767218-27767240 ATGGAACAGAAAAGGAAGAAGGG - Intergenic
1178451639 21:32707064-32707086 CAGTATGAAAAAAGGGAGAAAGG - Intronic
1179071099 21:38071807-38071829 GTGGAGAACAAAAGGGAGAAAGG - Intronic
1179100872 21:38354816-38354838 CTGAGCCAAAAGATGGAGAAAGG - Intergenic
1180041164 21:45280959-45280981 ATGGACCAAAAAAGAAAGATTGG - Intronic
1181432312 22:22888844-22888866 TTGGAGCAATAAAGGGAGAGGGG + Intronic
1181537018 22:23551621-23551643 ATGGAGAACAAAAGGGAGAATGG - Intergenic
1182168325 22:28199828-28199850 CTGGAGGAAAAATGGGAGAGGGG + Intronic
1182196481 22:28523967-28523989 GCGGAAGAAAAAAGGGAGAAAGG - Intronic
1182640704 22:31764745-31764767 ATGGAGAGAAAAAGGGAGAAGGG - Intronic
1182916571 22:34038349-34038371 CAGGAGGAAAAAAGGGAGAGAGG - Intergenic
1183613293 22:38925856-38925878 ATGGGCCCAAAAAGGGAGAAAGG - Intergenic
1184452113 22:44589305-44589327 CTGGACAAATGAAGGGAGAGAGG - Intergenic
1185381431 22:50509618-50509640 CGGGACAAAAACAGGGATAAGGG - Intronic
1185418768 22:50723579-50723601 CTGAACTAAAGAAGGTAGAATGG - Intergenic
950422701 3:12908078-12908100 CTGGAAGAAGAAAGGGAAAATGG + Intronic
950672269 3:14534400-14534422 CTGGAACAAAAAAGAGAGAGTGG - Intronic
951195733 3:19821385-19821407 CTGGACCAGAAAAAGGACATTGG + Intergenic
952040193 3:29252194-29252216 CTGCACCAAAAACTGGAGAGAGG + Intergenic
953675908 3:45002195-45002217 TTGGAGCATAAAAGGGGGAAAGG - Intronic
953750630 3:45605926-45605948 CTGGGACAAAGAAGGGAGACTGG - Intronic
954304413 3:49717882-49717904 CTGGACCGAAGCAGGGAGCAGGG + Exonic
955988415 3:64599412-64599434 ATGGACAAAATAAAGGAGAATGG + Intronic
956257626 3:67301277-67301299 GTGGAAGAAAAAAGGAAGAAAGG - Intergenic
956356343 3:68397071-68397093 ATGGAGGAAAAAAAGGAGAAAGG + Intronic
956356952 3:68404496-68404518 TAGGACCAAAAAAAAGAGAAAGG + Intronic
956677073 3:71745559-71745581 TTCGACCAAATAAGAGAGAAAGG + Intronic
956779817 3:72595086-72595108 ATGGACTAAAAACAGGAGAATGG + Intergenic
957620371 3:82585238-82585260 GTGGAACAGAAAAGGGGGAAAGG + Intergenic
957651543 3:83012831-83012853 ATGGAAAGAAAAAGGGAGAAAGG - Intergenic
958265221 3:91430215-91430237 CTTGAACAATAAAGTGAGAATGG + Intergenic
958479453 3:94628103-94628125 ATGGAAAAAAGAAGGGAGAAAGG - Intergenic
959629165 3:108489088-108489110 CTGGATTAAAAAATGGATAAAGG - Intronic
959749356 3:109814778-109814800 CTGGCACCACAAAGGGAGAAAGG - Intergenic
961904644 3:130250520-130250542 CTATAGAAAAAAAGGGAGAATGG + Intergenic
962492331 3:135906666-135906688 ATGGAGCAGAAAAGGTAGAAAGG - Intergenic
963001632 3:140687156-140687178 CTGAACCACAAGAGGGACAAAGG + Intronic
963751222 3:149181900-149181922 CTGGACCAAGAAAGTGAAAAGGG - Intronic
963763634 3:149310170-149310192 CAGGAGCAAAAGAGAGAGAAGGG - Intergenic
963935759 3:151051468-151051490 CTTGAACAAAAAAGGAGGAATGG - Intergenic
965076007 3:163977309-163977331 CTGGAATAAAAGAAGGAGAAGGG - Intergenic
965182205 3:165418388-165418410 CTATTCCAAAAAATGGAGAAGGG + Intergenic
965398485 3:168189352-168189374 CGGGAGGAGAAAAGGGAGAAAGG - Intergenic
966690773 3:182739119-182739141 CTGGATCAAAAAGGGAGGAAAGG + Intergenic
968796566 4:2710065-2710087 CTTAAGCAAAATAGGGAGAAAGG - Intronic
969073291 4:4557122-4557144 GTGGACCAAGAAATGGAGGAAGG - Intergenic
969451980 4:7279166-7279188 CACCACCAAAAAAGGGAGGAGGG - Intronic
969493264 4:7511925-7511947 CAGGACCTGCAAAGGGAGAAAGG - Intronic
969706161 4:8793213-8793235 ATGGACCAACACAGGGATAATGG + Intergenic
970013228 4:11483376-11483398 TTGTACCAGAAAAGGCAGAAGGG + Intergenic
970641584 4:18072196-18072218 CTGGAACAAAAAAAGGACATTGG + Intergenic
972575602 4:40348606-40348628 CTGGACCAAGAAAGTGACACTGG + Intronic
972644924 4:40958608-40958630 CTGTCTCAAAAAAGGAAGAAAGG - Intronic
973180041 4:47255917-47255939 ATGGGCCAGAAAAGGAAGAAAGG + Intronic
973641719 4:52909562-52909584 GCGGACCAAGCAAGGGAGAAAGG + Intronic
973896679 4:55420820-55420842 CTAGGCCAAAAAAGGGTGAGGGG + Intronic
974067976 4:57097979-57098001 CTTGTCCTAAAAAGGGAGATAGG + Intronic
975222668 4:71831751-71831773 CTGAAACAAAGAAAGGAGAAAGG - Intergenic
975400368 4:73930303-73930325 CTGGAGCAGAAAAGAGAGACAGG + Intergenic
975455467 4:74585173-74585195 CTTGACAAAAAAAGAGGGAAAGG + Intergenic
975517499 4:75262496-75262518 ATGGACAACAAAAGTGAGAAGGG + Intergenic
976022708 4:80649114-80649136 CTGGACTAACAAAGGGCGATAGG + Intronic
977009082 4:91613001-91613023 ATGGAGCAAAAAATGGACAATGG + Intergenic
977627307 4:99201303-99201325 CTGGACCAAACAATGAAGAGGGG - Intergenic
978876168 4:113642590-113642612 GTTGCCCAAAAAAGGGAGGAGGG - Intronic
979463725 4:121012396-121012418 TTGGACCAAAAGAAAGAGAAAGG - Intergenic
979560113 4:122092204-122092226 CTCAACCAGGAAAGGGAGAATGG - Intergenic
979641351 4:123015632-123015654 GTGGAACAGAAAGGGGAGAAAGG - Intronic
981035982 4:140169336-140169358 ATGGAGCAAAGGAGGGAGAAGGG - Intergenic
981844536 4:149152518-149152540 CTAGACCAGAAAAGAGTGAAAGG + Intergenic
982761812 4:159293780-159293802 CTGAGCCAAAAAATGGAGAGGGG - Intronic
983273682 4:165592178-165592200 CTGGCCCAGAAAGGGGAAAAAGG - Intergenic
983732697 4:171015675-171015697 ATGGACGAAGAAAGGGAGAAAGG + Intergenic
983883675 4:172959335-172959357 CTGGACCTAATAAGGGAGCTGGG + Intronic
984297280 4:177868409-177868431 CAGGACCAAAACAGGTAGAAGGG - Intronic
984624152 4:181986930-181986952 CTGGAGCAATGATGGGAGAATGG + Intergenic
985147481 4:186907701-186907723 TGGGACCAAAGAAGGCAGAAGGG - Intergenic
986067128 5:4245559-4245581 GTGGGCCAGAAAAGGGAGAGAGG - Intergenic
986817978 5:11433616-11433638 CGGGAGCAAAAGAGTGAGAAAGG + Intronic
989221237 5:38967696-38967718 ATGGGCCAAAAAAGGAAGAGAGG - Intronic
990136177 5:52646032-52646054 CAGGAGAAAGAAAGGGAGAAGGG - Intergenic
991469699 5:66954898-66954920 CTCAAAAAAAAAAGGGAGAAAGG + Intronic
992241713 5:74776571-74776593 CAAAACCAAAAAAGGGAAAAGGG - Intronic
993074551 5:83212506-83212528 CTGGGACAAAAGAGAGAGAAAGG + Intronic
994143900 5:96371473-96371495 CTGGAAGAAGAAAGGAAGAAAGG - Intergenic
994684396 5:102931420-102931442 CTGGTCAAAAAAAGGGGGAGAGG - Intronic
994762602 5:103875476-103875498 CTGGGACAAACAAGGGAAAATGG + Intergenic
994820107 5:104638677-104638699 ATGCACTAAATAAGGGAGAAAGG - Intergenic
995721019 5:115133024-115133046 TTTGAACAAAAAAGGAAGAAAGG + Intronic
996199535 5:120654156-120654178 AAGCAGCAAAAAAGGGAGAAGGG - Intronic
997636590 5:135412357-135412379 CTAGACCAAAAAAGTCAGTATGG - Intergenic
997792464 5:136772915-136772937 CTGGAGGAGAAAAGGGAGGAGGG + Intergenic
999107649 5:149087680-149087702 CAGGAGCAAAAGAGAGAGAAAGG - Intergenic
999866401 5:155705103-155705125 GTGGAAGAAGAAAGGGAGAATGG - Intergenic
1001055685 5:168448060-168448082 CAGGGGCCAAAAAGGGAGAAGGG - Intronic
1001437796 5:171714160-171714182 CTACACCCAAGAAGGGAGAATGG + Intergenic
1001715228 5:173810136-173810158 CTGGAACAAAACAGAGAAAAAGG - Intergenic
1001769626 5:174283476-174283498 CTGGAGCCAGAAGGGGAGAATGG + Intergenic
1002596968 5:180329968-180329990 ATGGCCCAAAAGAGGGAGAGAGG - Intronic
1004287866 6:14339409-14339431 ATAGACCAATATAGGGAGAATGG - Intergenic
1004560358 6:16743817-16743839 CTGGAGCAAAAAACAGAGTATGG + Intronic
1004611418 6:17244322-17244344 CTATTCCAAAAAATGGAGAAGGG + Intergenic
1004771412 6:18786247-18786269 CTGCTCCAAAAAAAGAAGAAGGG - Intergenic
1006664322 6:35679383-35679405 ATGGACCATAAAAGGGGAAAAGG + Intronic
1007124360 6:39412812-39412834 CTGGACCACAAAAAGGAACATGG - Intronic
1007850161 6:44795003-44795025 CAGCACCAAAAAAGGGAGCCTGG + Intergenic
1007851891 6:44811107-44811129 CTGGAGCAGAAACGGGACAATGG - Intronic
1008584281 6:52934885-52934907 CAGGACCAAGAAAGGGAGCGGGG - Intergenic
1008990157 6:57592442-57592464 CTTGAACAATAAAGTGAGAATGG - Intronic
1010659119 6:78548444-78548466 TTAGACTGAAAAAGGGAGAAGGG + Intergenic
1010783513 6:79972590-79972612 ATGAACCAAAAAAGGGAGGGAGG + Intergenic
1010984413 6:82406385-82406407 CTGGAGCTCAAAAGGAAGAAAGG + Intergenic
1012849596 6:104430823-104430845 ATGGACCACAAAAGGCACAAGGG + Intergenic
1013949117 6:115758246-115758268 ATGGGCCAGAAAAGTGAGAAAGG + Intergenic
1014760496 6:125351500-125351522 CTGGACCACAATAGGTAGAGAGG - Intergenic
1015190827 6:130470370-130470392 CTGGCTCAAGAAGGGGAGAAAGG + Intergenic
1016216488 6:141609780-141609802 CTGGAACAAAAAAAGGACATTGG - Intergenic
1016547346 6:145239072-145239094 AAGGAACAAAAAAGGGAGAGAGG - Intergenic
1018218447 6:161553402-161553424 AGGGACCAAAAAAGGAGGAAGGG - Intronic
1019183623 6:170208337-170208359 TTGGACCACAGATGGGAGAAAGG + Intergenic
1020440229 7:8209787-8209809 CAGGCACAAAAGAGGGAGAAGGG + Intronic
1020796527 7:12684349-12684371 CTGGAGCAAAAAGGGAAAAAAGG - Intergenic
1021046583 7:15930169-15930191 GTGGACCAAACAAGGGAAAGAGG - Intergenic
1021232113 7:18098043-18098065 CTGGACCAGAAAGGGTAAAAGGG - Intronic
1021402981 7:20231273-20231295 TTGGAGCAATAAAGGGAAAATGG + Intergenic
1022148084 7:27568197-27568219 CTTTACCAAAAAAAGGATAAAGG - Intronic
1022370151 7:29763362-29763384 TTATACCAAGAAAGGGAGAAAGG - Intergenic
1022898274 7:34774782-34774804 CTGGAGCAAGAAAGCAAGAAAGG - Intronic
1023517291 7:41014441-41014463 CTGGATTTAAAAAGTGAGAAGGG + Intergenic
1023583598 7:41706329-41706351 CAGGACCAGAAAAGGGAGTGGGG + Intergenic
1023673799 7:42608255-42608277 ATGGCCCAAAAAACTGAGAATGG + Intergenic
1023869608 7:44255980-44256002 CTGGACAGAAAAATGGGGAAAGG - Intronic
1024874945 7:54010953-54010975 CTGGACAAAAAAATGGGCAATGG - Intergenic
1026759916 7:73119035-73119057 ATGGACCAAGACAGGGAGAGAGG - Intergenic
1027036258 7:74927847-74927869 ATGGACCAAGACAGGGAGAGAGG - Intergenic
1027087306 7:75273617-75273639 ATGGACCAAGACAGGGAGAGAGG + Intergenic
1028719217 7:94010606-94010628 CTGGAAGAAAAAAGGAAGGAAGG - Intergenic
1029393612 7:100291587-100291609 ATGGACCAAGACAGGGAGAGAGG + Intergenic
1030368048 7:108668853-108668875 CTTGTCCAGAAAAGAGAGAATGG - Intergenic
1030567868 7:111183100-111183122 CTAAACCAAAAAATGAAGAAAGG + Intronic
1030906945 7:115197398-115197420 CTAGCCCAAGATAGGGAGAAGGG - Intergenic
1031669692 7:124527949-124527971 CAGGAGCAAGAAAGGAAGAAGGG + Intergenic
1031845134 7:126796662-126796684 CTAGACCAAAAAGGGAGGAATGG - Intronic
1031854732 7:126908120-126908142 CTGGAGCTAAAGAGAGAGAAGGG + Intronic
1032493966 7:132347240-132347262 CTGGGCTAGAAAAGGAAGAAAGG - Intronic
1032812997 7:135441849-135441871 GAGGAACAAAAAAGGGACAAAGG + Intronic
1032890449 7:136189620-136189642 CTGGACCAAAATAAAGATAAGGG - Intergenic
1033327038 7:140388426-140388448 CTGTACCAAAAAAAAGAGAAAGG + Intronic
1034786871 7:153934332-153934354 ATGGAAAAAAAAAAGGAGAAGGG - Intronic
1036193218 8:6690539-6690561 CTGGACCAAAATAGAAAAAAAGG + Intergenic
1036541736 8:9720682-9720704 CCCTACCAAAAAAGGGAGATGGG - Intronic
1036624948 8:10462630-10462652 GTGGACCAAAAAATTGAGTAAGG + Intergenic
1037484082 8:19331126-19331148 CTGTACCAAGAAGGGTAGAAAGG + Intronic
1037763814 8:21759379-21759401 CTGGCTCAAAAAAGAAAGAAAGG + Intronic
1038219751 8:25596025-25596047 CTGTCTCAAAAAAGGGAAAAAGG - Intergenic
1038240756 8:25806304-25806326 CTGGCCAAGAAAATGGAGAAAGG + Intergenic
1038334550 8:26635695-26635717 AGGGAACATAAAAGGGAGAAAGG - Intronic
1038388048 8:27168055-27168077 CTCCCCCAAACAAGGGAGAACGG - Intergenic
1039577442 8:38634695-38634717 CTGGACCCCAAAAGGAAGGAGGG - Intergenic
1040561084 8:48524072-48524094 CTGGCCCAGGAAAGGGAGCACGG - Intergenic
1040752180 8:50723785-50723807 ATGGAAAAAAAAAAGGAGAAAGG + Intronic
1040849775 8:51887367-51887389 CTGGATGAGAAATGGGAGAAGGG - Intronic
1042002907 8:64146291-64146313 CTTGTCCAAAAAGGGGAAAATGG - Intergenic
1042067127 8:64890456-64890478 CAGGAAAAAAAAAGGGAGAGGGG + Intergenic
1043338319 8:79204658-79204680 ATGGACCAAAAAAAAGACAAAGG + Intergenic
1043349272 8:79340745-79340767 CTGGTACAAAAAGGGCAGAAGGG + Intergenic
1044251029 8:90004034-90004056 ATGAATCAAAAAAGGAAGAATGG - Intronic
1044269618 8:90226330-90226352 CTTGAGGAAAAAAGGGAGTATGG + Intergenic
1044840676 8:96334135-96334157 CTAGAGCAGAAAAGGGAGAGAGG + Exonic
1044900310 8:96937015-96937037 CTGGAAAGAAAAAGGGAGGAAGG - Intronic
1044916216 8:97115068-97115090 CTGAACCAGAAAGGGGAGGAAGG + Intronic
1048043007 8:130748960-130748982 CTGGGGCAAGAGAGGGAGAAGGG + Intergenic
1048649637 8:136460758-136460780 AAGGAACAAAAAAGAGAGAATGG + Intergenic
1048694407 8:137009049-137009071 CATGACCAAAAAATGGAGTAGGG - Intergenic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1049941602 9:551253-551275 CTGGACAAAAAGAGGGAAACAGG - Intronic
1050016107 9:1236172-1236194 CTGGCCCAATAAAGGGAAACCGG - Intergenic
1050128490 9:2384690-2384712 CTTGACTCAAAAGGGGAGAAAGG + Intergenic
1050296953 9:4215088-4215110 GTGGAGCAAAGAAGGGAGATTGG + Intronic
1050678113 9:8079266-8079288 CTGGTCCAAAGAGGAGAGAACGG + Intergenic
1050684688 9:8154642-8154664 CTGGACCCAAAAAGGGACTTAGG - Intergenic
1051140701 9:13976238-13976260 CTTGAGCAAAAAGGGGGGAAAGG + Intergenic
1051366563 9:16325518-16325540 CTGGACTGAAACAGGGACAAAGG - Intergenic
1051446129 9:17141179-17141201 CTGTAACTAAAAAGAGAGAATGG + Intronic
1052441375 9:28500076-28500098 CAAGACCAAAACAGGGAGAAGGG - Intronic
1052829915 9:33206819-33206841 CTGGACCAATCAAGTGACAAAGG + Intergenic
1055295115 9:74826082-74826104 CTGTACCAAAGGAGGGAAAAAGG + Intronic
1055566331 9:77572362-77572384 CTGACCCAAGAAAGGAAGAATGG - Intronic
1055731330 9:79281954-79281976 CTGGAGCAAATTAGGGAGAGGGG + Intergenic
1056205350 9:84314640-84314662 CTGTAACAAAAAAGGAAGTATGG - Intronic
1058092630 9:100822864-100822886 CTGTAACAATAAATGGAGAATGG - Intergenic
1058664474 9:107297705-107297727 CTGGACCAAAAAAAAAAAAAAGG - Intronic
1060543177 9:124445389-124445411 CAGGACCAAGAAAGAGAGAGGGG + Intergenic
1062694655 9:137867241-137867263 CTAAGCCTAAAAAGGGAGAAAGG - Intronic
1203441881 Un_GL000219v1:16387-16409 GTGGGCCAGAAAAGGAAGAAGGG - Intergenic
1203512689 Un_KI270741v1:135296-135318 GTGGGCCAGAAAAGGAAGAAGGG - Intergenic
1203607659 Un_KI270748v1:70683-70705 CTGAGCCAGAAAAGTGAGAAGGG + Intergenic
1185617546 X:1432525-1432547 TCGGACAAGAAAAGGGAGAAAGG + Intronic
1185700460 X:2227538-2227560 GAGGAAGAAAAAAGGGAGAAAGG + Intronic
1185871540 X:3668819-3668841 CTGGGGCAGAAAAGGGAGAAAGG + Intronic
1190057028 X:47187007-47187029 CTGGAACCAACAAGGGAGAGGGG - Intergenic
1190108135 X:47573485-47573507 ATGGACCAGAAAAGGCAGATGGG + Intronic
1190948875 X:55122898-55122920 CTTAACCATAAAAGGGAGAGGGG + Intronic
1191943664 X:66505525-66505547 GTGGCTCAAAAAAGAGAGAAAGG + Intergenic
1192000082 X:67140509-67140531 CTGGACCCAACAATGGAGAATGG - Intergenic
1192369063 X:70498497-70498519 CTGCAACAAAAAAGAGAGATAGG - Intronic
1192815852 X:74591275-74591297 CTGGAACAAAAACTGGAGAAAGG + Exonic
1193276819 X:79598605-79598627 CTGGACAAATAAATAGAGAAGGG - Intergenic
1193330327 X:80229181-80229203 CTGGGCCTAGAGAGGGAGAAAGG - Intergenic
1193478630 X:81998159-81998181 CATGACCAAAATAGGAAGAAAGG - Intergenic
1193964166 X:87963541-87963563 CTAGACCAAAGAAGTGAGATAGG + Intergenic
1194397288 X:93401964-93401986 ATTGACCAAAAAAGGGACTATGG - Intergenic
1196068063 X:111487737-111487759 CTGGGACAAAGAAGGGGGAAAGG - Intergenic
1197621767 X:128758553-128758575 CTTTACCAAAAAAGGAAGGAAGG + Intergenic
1198636647 X:138709469-138709491 TTATACCAAAAAAGGGAGGAGGG + Intronic
1199431405 X:147764491-147764513 CTGTAGCAGAAAAGGGAAAAAGG - Intergenic