ID: 926957716

View in Genome Browser
Species Human (GRCh38)
Location 2:18319717-18319739
Sequence TAGAGTGACCATGATGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926957716 Original CRISPR TAGAGTGACCATGATGGGCT AGG Intronic
900354577 1:2254105-2254127 TCCAGTGACCATGAGGGGCTGGG + Intronic
901646001 1:10717046-10717068 TAGAGAGACTCAGATGGGCTGGG + Intronic
903096617 1:20982021-20982043 TAGCTTGACCCTGATGGACTGGG - Intronic
905269426 1:36777333-36777355 AAGTGGGACAATGATGGGCTGGG + Intergenic
905656193 1:39687430-39687452 GAGAGTCAGCATGAGGGGCTGGG + Intronic
907109033 1:51909649-51909671 TAGCATGACCTTGTTGGGCTGGG - Exonic
907271732 1:53295307-53295329 CAGAGTGACCATTAGGGGCTGGG + Intronic
909814862 1:79979115-79979137 GAGATTGACCAAGATGGGGTGGG + Intergenic
910889362 1:92001173-92001195 TAGAATTACCAGGATTGGCTTGG + Intronic
912106842 1:106288837-106288859 TAAAATGCACATGATGGGCTGGG - Intergenic
912383668 1:109260845-109260867 CAGGGTGCCCATGAAGGGCTGGG + Intronic
915001254 1:152595067-152595089 TAGACTGAACATGAAGGGATGGG - Intronic
919246871 1:194999292-194999314 TAAAGTCACAATGATGGGGTGGG + Intergenic
922169176 1:223140731-223140753 AAGAATGACCATCAAGGGCTTGG - Intronic
923326197 1:232882456-232882478 TGGAGTGAAGAAGATGGGCTGGG - Intergenic
1064185524 10:13158631-13158653 TAGAGGGAGCAGGAAGGGCTCGG + Intergenic
1069453406 10:68535189-68535211 GAGAGTGAGCAAGATGGGCATGG - Intergenic
1072299409 10:94044738-94044760 TAGCATGACCATGTGGGGCTGGG - Intronic
1074783669 10:116820314-116820336 TTTAGGGACCATGATGGGGTGGG + Intergenic
1079239304 11:18711309-18711331 TAGATTGAGAATGATGGGATTGG - Intronic
1087872750 11:103317992-103318014 TTGAGTAACTATGATGGGCTAGG - Intronic
1089189640 11:116644535-116644557 AAGAGTGACCCGGATGAGCTGGG + Intergenic
1090831347 11:130422840-130422862 TAGAGTGGGGAGGATGGGCTGGG - Intronic
1091975074 12:4817769-4817791 TAGAGTAACAATGATGAGGTTGG - Intronic
1092004507 12:5057849-5057871 AAGTGTGAACATGAGGGGCTGGG + Intergenic
1093828147 12:23720832-23720854 TAAAGTCAACATGATGGGCTCGG + Intronic
1095857643 12:46878271-46878293 TACAGTGGCCATGATGGTATTGG - Intergenic
1097680791 12:62647209-62647231 TAGAGGGACCTTGAGGAGCTGGG + Exonic
1106302475 13:28481591-28481613 TTGAGTGACCATTATGTGCCAGG + Intronic
1106368966 13:29112885-29112907 GAGAGTAACCATGATGGAATTGG + Intronic
1111653449 13:91122994-91123016 TAGACTGCTCATGATTGGCTAGG + Intergenic
1114633579 14:24174708-24174730 AGGGGTGACCATTATGGGCTAGG - Intronic
1116243477 14:42378705-42378727 TAGAGTGCCCATGATAGTCAAGG - Intergenic
1116339786 14:43707053-43707075 GAGAGTGACCATTATGGGGATGG + Intergenic
1118305679 14:64653222-64653244 TAAAATGTCCATGATAGGCTGGG + Intergenic
1118428047 14:65688945-65688967 TAGAGTTCCCATGATGGAATTGG - Intronic
1121654535 14:95585616-95585638 TAAAGTGACCTTGCTGGGTTTGG - Intergenic
1122540959 14:102497437-102497459 CGGAGTGCCCATGATGGGCTGGG - Intronic
1124292050 15:28461594-28461616 TAGAGTGACCATGAAGCCATGGG + Intergenic
1126701708 15:51373692-51373714 CAGAGTGACAGTGATGGGCAGGG + Intronic
1129055340 15:72815775-72815797 TAAAGAGACCATGATGAGCCTGG + Intergenic
1131182719 15:90251417-90251439 AAGACAGACCAGGATGGGCTGGG - Intronic
1134060605 16:11197478-11197500 CTGAGTGACTATAATGGGCTCGG - Intergenic
1135853032 16:25981757-25981779 TTGAGTGACTATCATGTGCTAGG - Intronic
1136101452 16:27999519-27999541 TAGAGTTCCCATGATGGGCCAGG - Intronic
1136923822 16:34352856-34352878 TGGAGTGACCATTATCGGCCTGG + Intergenic
1137910599 16:52373962-52373984 TAGAGAGAGCAAGATGTGCTTGG - Intergenic
1137923540 16:52516980-52517002 TTGAGTGTCCATGATGTTCTAGG - Intronic
1138316253 16:56072751-56072773 AAGAGTGACCATTATGGGTGGGG - Intergenic
1138754104 16:59460868-59460890 AAGAGAGAGCATTATGGGCTGGG + Intergenic
1138907293 16:61352816-61352838 TACAGTGACCTTGATGAGATTGG + Intergenic
1141429180 16:83962151-83962173 TAGGGTGGCCATGATGGGGCAGG - Intronic
1143091389 17:4450976-4450998 TGGAGGGAACATGAAGGGCTTGG + Intronic
1144084007 17:11791984-11792006 AAAAGTGATCATGAGGGGCTGGG + Intronic
1144562128 17:16329515-16329537 GAGAGTGACCAGGCTGGGGTGGG + Intronic
1145736167 17:27233263-27233285 GAGAGAGTCCATGATTGGCTGGG - Intergenic
1151696799 17:75721957-75721979 TAGATGCGCCATGATGGGCTGGG - Intronic
1153586660 18:6628111-6628133 TCAACTGACCATGATGAGCTGGG + Intergenic
1154077241 18:11215416-11215438 CAGAGTGATCATGAGGGGTTGGG + Intergenic
1155278980 18:24218739-24218761 TATAGTCACCATGTTGGGCCAGG - Intronic
1156279894 18:35626968-35626990 TAGAATGACCGTGGTTGGCTTGG + Intronic
1157529110 18:48407483-48407505 TAAAGAGGCCATGATGGGCTTGG + Intronic
1158689245 18:59645524-59645546 TAGAGAGACCTTGATGGAATGGG - Intronic
1163799949 19:19358473-19358495 TTGAGCCACCATGCTGGGCTGGG - Exonic
1165244356 19:34489644-34489666 TAAAGATACCATGATAGGCTGGG + Intronic
926957716 2:18319717-18319739 TAGAGTGACCATGATGGGCTAGG + Intronic
928105718 2:28469428-28469450 CAGAGTGGCCCTGATTGGCTAGG - Intronic
930851996 2:55971448-55971470 TAAAGTGACAATGATGGAATAGG - Intergenic
932764489 2:74461342-74461364 TACAGTGACCGCGATGGGCGAGG - Exonic
934921907 2:98350948-98350970 TGGAGGGACCTTGATGGGTTTGG + Intronic
935599378 2:104907088-104907110 TAGGATGACGATGAGGGGCTGGG - Intergenic
935919625 2:107998672-107998694 TGGTGTGTCCATGCTGGGCTAGG + Intronic
937555513 2:123150280-123150302 TAGAGTGACCAGGAAAGGGTTGG - Intergenic
937797815 2:126045806-126045828 AAAAGAGACCAAGATGGGCTCGG - Intergenic
937937638 2:127258962-127258984 TGGAGGGAGCATGATGGGCTGGG - Intronic
938851887 2:135268697-135268719 TAGAGGTACAATGATGGGGTTGG - Intronic
939569895 2:143828942-143828964 TAGAGGGATCATCATGGACTTGG - Intergenic
940296638 2:152131764-152131786 TACAGTGGCAATGATGGGCACGG + Intronic
940319804 2:152365043-152365065 TTGGGTGACCATGGTGTGCTGGG + Intronic
940674795 2:156714752-156714774 TAGAGCAACCATGCTGTGCTAGG + Intergenic
941698932 2:168582888-168582910 TAGAGGGGCCTTGATGGGCATGG + Intronic
942208202 2:173644734-173644756 TTGAGTGATCATGATGGACAAGG + Intergenic
942466429 2:176212327-176212349 TAGAGTGACCAAGATGGCCAAGG + Intergenic
943621675 2:190155210-190155232 TAGAGTGAGAATGAAGGGCAAGG - Intronic
944902991 2:204234826-204234848 TAGAGTGATCCTGCTGGGATGGG + Intergenic
945497979 2:210533098-210533120 TAGTGTGACCATGAAGGACAGGG + Intronic
1169066349 20:2696179-2696201 TAAAGTGACCAGGCTGGGCGCGG + Intronic
1172107723 20:32526809-32526831 TTGAATGAGCATGAAGGGCTTGG + Intronic
1172602760 20:36195250-36195272 TAGAGATACCACGATGGGCTTGG - Intronic
1176025081 20:62981671-62981693 TAGAGAGGCCATGAAGAGCTGGG + Intergenic
1179150446 21:38805091-38805113 GAGAGTGACGATGATGTGCGTGG + Intergenic
1179160574 21:38893693-38893715 TAGAGTGAGCAAGAAGGGATTGG + Intergenic
1180192544 21:46172980-46173002 TAGAGTGTCCATGGTGGGCAAGG - Intronic
1184867273 22:47208703-47208725 TGGAGTGAATTTGATGGGCTGGG - Intergenic
949698336 3:6726075-6726097 TATAGTGACCATGAAGGGTTTGG + Intergenic
950834208 3:15903737-15903759 TTGAGTGCCTATGCTGGGCTGGG + Intergenic
954335213 3:49912285-49912307 CAGTGTGACCAAGATGGGCAAGG - Intronic
955929186 3:64038616-64038638 TGGAGGGACCATTATTGGCTGGG - Intergenic
956672132 3:71700927-71700949 TATAGTCACCATGACAGGCTTGG + Intronic
962022137 3:131512312-131512334 CAGAGTGTCCATGATGGTCCAGG + Intergenic
967121287 3:186385040-186385062 GAGAGTGGCCATGATGGTGTTGG + Intergenic
971265528 4:25093461-25093483 TGGGATTACCATGATGGGCTAGG + Intergenic
975470905 4:74766180-74766202 GTGAGTGAACATGATGGCCTAGG + Intronic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
976914968 4:90360744-90360766 TATATTGACCATGATCAGCTAGG - Intronic
979671706 4:123366485-123366507 TACAGTGATTATGATGAGCTGGG + Intergenic
984068799 4:175085652-175085674 TCAAATGTCCATGATGGGCTGGG + Intergenic
986728518 5:10617928-10617950 TAGAGTGGTCAGGCTGGGCTTGG - Intronic
987378435 5:17259815-17259837 TAGACAGACCATGATGGGCTTGG - Intronic
988599967 5:32630804-32630826 TAGGGTGACCATTATGTGATAGG + Intergenic
1003360357 6:5419873-5419895 TAAAGTGAGCCTGCTGGGCTTGG - Intronic
1007129958 6:39462548-39462570 TACAATGAGCATGATGGGCTGGG + Intronic
1011499305 6:87970274-87970296 GCGATTGACCTTGATGGGCTAGG + Intergenic
1011636549 6:89380085-89380107 CGGAGTCACCATGATTGGCTTGG - Intronic
1011762423 6:90582653-90582675 TAAAGTGACCATCGTGGGTTGGG - Intronic
1016515258 6:144885944-144885966 AACAGTGAACATGAAGGGCTTGG - Intergenic
1016551034 6:145280607-145280629 TAGACTGGCAATGATGGACTGGG + Intergenic
1018387947 6:163321945-163321967 TAGAGTGAGGACGAGGGGCTGGG - Intergenic
1018422984 6:163655357-163655379 CAGACTGCCCATGATAGGCTGGG - Intergenic
1019821522 7:3246886-3246908 CAGAGTGACTATGATGTGCCTGG + Intergenic
1022219520 7:28298952-28298974 GACAGTGACGATGATGGGATGGG - Intergenic
1025030108 7:55549919-55549941 TGCAGTGACCATGATGGGGATGG - Intronic
1034254195 7:149715322-149715344 TAGAGTGGGCATGAAGGCCTCGG + Exonic
1037945689 8:22988069-22988091 TAGAGTGGGCATGAGGGCCTAGG - Intronic
1038348537 8:26755299-26755321 CAGAGTGACCATGTTTGGCTTGG - Intronic
1039615358 8:38951042-38951064 TGGTGTGCCCATGATGTGCTCGG + Intronic
1039743482 8:40402970-40402992 CAGAGTGAGCATGATAAGCTAGG + Intergenic
1044020849 8:87104028-87104050 TATAGAGACCATGATGGTCATGG + Intronic
1047718410 8:127616881-127616903 TAGAGTGCTCATTATGGGCCAGG - Intergenic
1048312696 8:133337930-133337952 TCGAGTGCCCATGATGTTCTAGG - Intergenic
1048574162 8:135677919-135677941 TGGAGTGACCATGCTGGGCCAGG + Intergenic
1048620859 8:136131653-136131675 TTGAGTGTCCATTATGTGCTAGG + Intergenic
1048636389 8:136300449-136300471 GAGAGTGACCATGTTGGCCTGGG + Intergenic
1051874513 9:21777251-21777273 TAGGGTGAACATGATGGGGTTGG + Intergenic
1052702953 9:31960059-31960081 TAGAGTGACTGTGCTGTGCTGGG - Intergenic
1186078902 X:5909105-5909127 GAGAGTGACCATCTTTGGCTCGG - Exonic
1186951167 X:14626989-14627011 GAGAGGGACCATGAAGAGCTAGG + Intronic
1189766904 X:44381284-44381306 CAGAGAGATCATGATTGGCTTGG + Intergenic
1192763603 X:74121309-74121331 TGGAGTGACTATGATGGTATTGG + Intergenic
1193317724 X:80083183-80083205 TAGATTTAGCATTATGGGCTGGG - Intergenic
1195713944 X:107799568-107799590 CAGAGTGACTATTATGTGCTAGG + Intergenic
1198752171 X:139946812-139946834 AAGAGTGACGGTGTTGGGCTGGG - Intergenic