ID: 926961511

View in Genome Browser
Species Human (GRCh38)
Location 2:18363258-18363280
Sequence AATGCTGATGCCACTTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 317}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926961509_926961511 -4 Left 926961509 2:18363239-18363261 CCATGGCTGAGTCTATAGAAATG 0: 1
1: 0
2: 0
3: 6
4: 147
Right 926961511 2:18363258-18363280 AATGCTGATGCCACTTTTCTGGG 0: 1
1: 0
2: 5
3: 29
4: 317
926961508_926961511 2 Left 926961508 2:18363233-18363255 CCAGTGCCATGGCTGAGTCTATA 0: 1
1: 0
2: 0
3: 11
4: 86
Right 926961511 2:18363258-18363280 AATGCTGATGCCACTTTTCTGGG 0: 1
1: 0
2: 5
3: 29
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926961511 Original CRISPR AATGCTGATGCCACTTTTCT GGG Intergenic
900533751 1:3167336-3167358 AAAGCTGCTCCCAGTTTTCTGGG + Intronic
900939470 1:5788904-5788926 AGTGCTGATGAGACTTTTCTGGG - Intergenic
902676436 1:18011824-18011846 AAATGTGATGCCAGTTTTCTAGG + Intergenic
904096185 1:27979360-27979382 AATGTTGATGCCATATTTATTGG - Intronic
908911878 1:69080863-69080885 AATGCTGAAGCCTCTTTCTTTGG - Intergenic
909068138 1:70961057-70961079 AATGCTGATGCTGCTGATCTGGG + Intronic
909192347 1:72570078-72570100 AATGCTGATGCTACTCTTCTGGG - Intergenic
909734898 1:78945916-78945938 AATGCAAATGACAATTTTCTTGG + Intronic
910189861 1:84584346-84584368 AATGCTGATGCAGCTAATCTAGG + Intergenic
911213752 1:95169254-95169276 CATGCTGATGCTGCTTATCTGGG + Intronic
912603226 1:110960690-110960712 AATTATGATGCCAGTTTTCTGGG - Intronic
912714091 1:111969848-111969870 ACTGCGGATGACACTTTCCTGGG + Intronic
912792022 1:112661641-112661663 AATGCTGATACCATGGTTCTAGG - Intronic
912919720 1:113854268-113854290 GATGCTGATGCTTCTTGTCTGGG + Intronic
913460567 1:119081954-119081976 AATGATGAACCCATTTTTCTTGG - Intronic
916212534 1:162370552-162370574 AGAGCTGATGCCACTTGGCTTGG - Intronic
917393596 1:174566906-174566928 AAGGCTGATGAAGCTTTTCTGGG - Intronic
917586821 1:176435423-176435445 AATGCAGATGATACTTTTCCAGG + Intergenic
917735740 1:177918455-177918477 AATGCATCTGCCACTTCTCTTGG + Intergenic
918975639 1:191481964-191481986 AATGCTTAGGTCACTTTCCTAGG - Intergenic
919233439 1:194806407-194806429 AATGCTTATGTTATTTTTCTGGG - Intergenic
919508627 1:198431858-198431880 AATGATGATGCTACTTTGATGGG + Intergenic
922631684 1:227121149-227121171 GATGCTCATGTCACTTGTCTGGG - Intronic
1064209276 10:13349051-13349073 AATGCCGATCGAACTTTTCTAGG + Intergenic
1065542260 10:26782094-26782116 ACTGCTGATGACACTTTTCCAGG + Intronic
1065569999 10:27061018-27061040 AGTTATGATGCCACTTTACTTGG + Intronic
1065770380 10:29072620-29072642 GATGCTGATGCTACTGCTCTGGG - Intergenic
1067666247 10:48281672-48281694 AAAGTTGATGCCACATTTTTGGG + Intergenic
1067980052 10:51074382-51074404 AGTGCAGATTCCACTTCTCTGGG - Exonic
1068222326 10:54059684-54059706 GATGCTGATGCTGCTTTTCCAGG + Intronic
1069217372 10:65838861-65838883 AATGCTGAAACCTCTTTTGTGGG + Intergenic
1069691236 10:70354332-70354354 GATTCTGATGCCACATGTCTAGG + Intronic
1070226624 10:74515295-74515317 AATGGTGATGCCACTTTGCCAGG + Intronic
1071628761 10:87200330-87200352 CATGCTGGTGCCCCTTCTCTAGG + Intergenic
1072708493 10:97699640-97699662 AATGCTGCTGCTGCTTTTTTTGG + Intergenic
1073494029 10:103875197-103875219 AAAGCTCATGCCCCTTTTCCTGG + Intergenic
1073898129 10:108186484-108186506 AAAGCTGTTGCCACAATTCTTGG + Intergenic
1074966791 10:118497911-118497933 AGAGCTGATGCCACTTATATTGG - Intergenic
1075451321 10:122553631-122553653 AATGCTGATGCTAGTGGTCTAGG + Intergenic
1075645781 10:124095091-124095113 GATGATGATGCCATTTTTCAAGG + Intergenic
1076053501 10:127353073-127353095 CTTTCTGATGCCACTTTCCTGGG + Intronic
1077853635 11:6099915-6099937 AATGCAGATGCCCCCTTTGTTGG - Intergenic
1078327614 11:10393358-10393380 ATTCCTGCTGCCACTCTTCTTGG + Intronic
1078353844 11:10618611-10618633 TCTGCTCATGTCACTTTTCTTGG - Intronic
1078809728 11:14746429-14746451 AAAGCTAATGCCCTTTTTCTAGG + Intronic
1078923501 11:15853314-15853336 GATGCTGATGCCACCAATCTAGG + Intergenic
1078999972 11:16744225-16744247 ATTGCTGATGCTATTTATCTGGG - Intronic
1079152869 11:17916884-17916906 AATGCTGATGCTACTGATTTAGG - Intronic
1081302518 11:41469722-41469744 AAAGCTGCTGAAACTTTTCTTGG - Intergenic
1082647317 11:55743908-55743930 CAAACTGATGCCATTTTTCTGGG + Intergenic
1083548891 11:63570508-63570530 AATTTTGATGACATTTTTCTTGG + Intergenic
1083553807 11:63610052-63610074 AATCCTGGTGCTACTTTTCGGGG - Intronic
1084972878 11:72781270-72781292 GATGCTGACGCCACCTTCCTGGG + Exonic
1085192398 11:74639121-74639143 AATGCTGATGCTGCTGGTCTGGG - Intronic
1085415201 11:76315115-76315137 AGTGCTGATTCCACTTTTAGTGG + Intergenic
1085508650 11:77074299-77074321 AATGCTGATGCCCCTCTGCCTGG + Intronic
1085556507 11:77427608-77427630 AATGCTGATGGAACTTGTCAAGG - Intronic
1087209086 11:95427945-95427967 CAGGCAGATGCCACTATTCTTGG - Intergenic
1088169797 11:106982921-106982943 AATGCTGATGCTGCTTGTCCAGG - Intronic
1090130204 11:124134220-124134242 AATGCTGATGCCACTAGACTTGG + Intronic
1091349375 11:134880926-134880948 AATGCTGATGCCACCACTCCAGG - Intergenic
1092223015 12:6728174-6728196 AATCCTGATTTCAGTTTTCTGGG - Intronic
1092933295 12:13337413-13337435 AATGCCAATGCCAAGTTTCTGGG + Intergenic
1093080150 12:14801571-14801593 AAAGGTGATGCCATCTTTCTTGG - Intronic
1094093970 12:26682886-26682908 AATGCTGATGCCACTGGTCTAGG - Intronic
1095520363 12:43056691-43056713 AAAGCAGAAGCCACTATTCTTGG + Intergenic
1095792727 12:46185239-46185261 GATGCTGATGCTACTGGTCTAGG + Intronic
1095840076 12:46683235-46683257 GATGCTGACTCCAGTTTTCTCGG - Intergenic
1096883347 12:54691400-54691422 AATGGGGAAGGCACTTTTCTAGG + Intergenic
1098613597 12:72493822-72493844 AAGGCTGATGTGAGTTTTCTAGG - Intronic
1101848277 12:108381344-108381366 AATGTTGATGCCACTGGTTTGGG + Intergenic
1106134735 13:26965667-26965689 ACTGCTGCTTCCCCTTTTCTGGG - Intergenic
1106975074 13:35201803-35201825 AATGGAGATGCACCTTTTCTGGG - Intronic
1107002225 13:35561017-35561039 GATGCTGATGCCATTGATCTAGG + Intronic
1107562453 13:41570492-41570514 AATGCTTTTGCCATTTTTATTGG - Exonic
1108577420 13:51802288-51802310 GATGCTGATGCAGCTTGTCTGGG - Intronic
1110873879 13:80485727-80485749 AAAAGTGATGCCACATTTCTGGG + Intergenic
1110911758 13:80974397-80974419 AATCATGATTCCCCTTTTCTAGG + Intergenic
1114724887 14:24925577-24925599 AATGCTGAAGCCACTCTTCTTGG - Intronic
1115488977 14:33940631-33940653 AATGGTGATGCCTCTTATCCAGG + Intronic
1117882014 14:60321299-60321321 AATGCTGATGACACTTCATTGGG + Intergenic
1120077276 14:80173054-80173076 GATGCTGAAGCCACTTCTCAAGG - Intergenic
1120750442 14:88192565-88192587 AATTCTGAATGCACTTTTCTAGG - Intronic
1122007096 14:98714685-98714707 AATGCTGCTGCCCCTTAACTAGG + Intronic
1122375595 14:101254973-101254995 CATGATGATGCCATTTTTCCAGG + Intergenic
1125217375 15:37290750-37290772 AAAGCTGCTTCCACTTTTTTAGG + Intergenic
1125277042 15:38004214-38004236 AGTCCTGAGGCCTCTTTTCTAGG - Intergenic
1126550966 15:49928954-49928976 GATGCTGATGCCACTGGTCAGGG - Intronic
1126863411 15:52910527-52910549 AATACTGATTTCACTATTCTAGG - Intergenic
1127969127 15:63945271-63945293 ACAGGTGATGCCACTTTCCTGGG + Intronic
1128843373 15:70868655-70868677 GATGCTGATGCAACTGGTCTGGG + Intronic
1129764765 15:78156335-78156357 AAGGCTCATACCAGTTTTCTCGG - Intronic
1129955203 15:79630091-79630113 ACTGCTGTTGACACTTTTCTAGG + Intergenic
1130159139 15:81381573-81381595 ATTACTGTTGCCATTTTTCTTGG + Intergenic
1130232075 15:82104732-82104754 GATGCTGAGGCCACTGGTCTGGG + Intergenic
1130368481 15:83262659-83262681 GATGCTGATGTTACTATTCTGGG - Intronic
1130368487 15:83262752-83262774 GATGCTGATGTTACTATTCTGGG - Intronic
1131196954 15:90363473-90363495 AATGCTGATGCTACTGGACTGGG - Intronic
1131941673 15:97573836-97573858 AATTTTGATGTCACTTTGCTGGG - Intergenic
1132473473 16:120015-120037 AATGCTGATGCCTCCTGCCTGGG + Intronic
1132990383 16:2789524-2789546 CATTCTAAGGCCACTTTTCTTGG + Intergenic
1133467963 16:6046238-6046260 ATTCCTACTGCCACTTTTCTAGG - Intronic
1133714477 16:8433691-8433713 GATGTTGATGCCACTGGTCTGGG - Intergenic
1134309883 16:13066169-13066191 CATGGAGATGGCACTTTTCTCGG + Intronic
1135183603 16:20295879-20295901 AATGCTGATGCTGCTGTTCTGGG + Intergenic
1135833580 16:25801120-25801142 AATGTTGATGCCGCTGGTCTGGG + Intronic
1136776515 16:32874608-32874630 AAGGCTGATACCACTTCTCCAGG + Intergenic
1136894100 16:33986904-33986926 AAGGCTGATACCACTTCTCCAGG - Intergenic
1137016077 16:35376857-35376879 AATGCATATGCCAGTTATCTTGG + Intergenic
1138536887 16:57665020-57665042 AATGCTTACGCCAGTTTGCTAGG - Exonic
1139547916 16:67658310-67658332 GATGCTGGTACCACTTTCCTCGG + Exonic
1140309674 16:73836994-73837016 GATGCTGATGCCATGGTTCTTGG + Intergenic
1140725744 16:77810253-77810275 AATGCTGATGCTGCTGATCTGGG - Intronic
1140785355 16:78336147-78336169 GATGTTGATGCTACTTGTCTTGG + Intronic
1141498555 16:84427347-84427369 AATGTTGAAGCCATTTTCCTAGG + Intronic
1203078930 16_KI270728v1_random:1136717-1136739 AAGGCTGATACCACTTCTCCAGG + Intergenic
1142781010 17:2181249-2181271 AATTCTGATTCCACTTTTCCAGG + Intronic
1147879378 17:43644045-43644067 AATGCTGATGCTGCTGATCTGGG - Intronic
1148519970 17:48264034-48264056 AAAGCTGATGTCTCTTTGCTTGG - Intronic
1149635558 17:58166228-58166250 AATGCTGATGCACCTGTTCCAGG - Intergenic
1153138376 18:1943261-1943283 GATGCTGATGCCATGCTTCTTGG + Intergenic
1153789637 18:8565922-8565944 AATTATGATGACAATTTTCTAGG + Intergenic
1153993425 18:10419776-10419798 CATGCTAATGCCACTGTTTTTGG - Intergenic
1154494672 18:14946762-14946784 AGGGCTGATACCATTTTTCTAGG - Intergenic
1156135106 18:34028328-34028350 ACTGCTGATGGCACATTTCCAGG + Intronic
1157199349 18:45646005-45646027 CATGCTACTGTCACTTTTCTGGG - Intronic
1158135478 18:54203261-54203283 AATACTGAAGCCCCTTTTATAGG + Intronic
1158229039 18:55233414-55233436 AATGCAGATTCCACTTCTGTAGG - Intronic
1158732931 18:60045584-60045606 GATGCTGATGCCGCCTGTCTGGG + Intergenic
1159273433 18:66184155-66184177 AATTCTGGTGACATTTTTCTTGG - Intergenic
1159601804 18:70435133-70435155 TTTGCTGATGCTACTTCTCTGGG + Intergenic
1162971819 19:14185238-14185260 AAGGCTGATGCCAGTGTGCTGGG - Intronic
1164637194 19:29800173-29800195 AATGGTGGTGCCATTTTTCTGGG + Intergenic
925026830 2:615741-615763 AGTTCTGATGGTACTTTTCTTGG - Intergenic
926075255 2:9937816-9937838 AATGCTGATGTCACTGGTCCAGG - Intergenic
926961511 2:18363258-18363280 AATGCTGATGCCACTTTTCTGGG + Intergenic
927050857 2:19327239-19327261 AATGCAGATGCCATTTTTAATGG - Intergenic
928230060 2:29490443-29490465 GATGCTGATGCCGCTGATCTAGG - Intronic
928893145 2:36229367-36229389 TCTGCTGAAGCCTCTTTTCTTGG + Intergenic
929161098 2:38832921-38832943 AATGCTGTAGGCACTGTTCTAGG + Intronic
930223845 2:48772012-48772034 ATTGCTGATTCCACTGTTATGGG + Intronic
930998740 2:57755660-57755682 AATGCTGATGCTACTTTTCCAGG + Intergenic
932089140 2:68789496-68789518 AATGCTAATGTCCCCTTTCTTGG - Intronic
933011727 2:77073063-77073085 GATTCTGATGCCACTGGTCTGGG - Intronic
933444393 2:82360119-82360141 AATGCTGATCTCATTTCTCTTGG + Intergenic
934578924 2:95422721-95422743 AATGCTGATGCTGCTAGTCTGGG + Intergenic
934600523 2:95653982-95654004 AATGCTGATGCTGCTAGTCTGGG - Intergenic
934738616 2:96703125-96703147 CTTGCTGATGTCATTTTTCTGGG + Intergenic
935606248 2:104974677-104974699 AATGCTGAGGGCACTATTCAAGG + Intergenic
935611676 2:105032174-105032196 AATGCTGATGCTCCTGCTCTGGG + Intergenic
936629864 2:114190628-114190650 ATTGTTGAGGCCACTTTTGTTGG - Intergenic
940833921 2:158499293-158499315 GATGCTGAACCCACTTTTGTTGG - Intronic
942370845 2:175282833-175282855 AATGCAGATGCCACCTTTTACGG + Intergenic
942735591 2:179108199-179108221 AATGCTTTTGGCTCTTTTCTCGG - Exonic
942974598 2:182000410-182000432 CATGCTAATGCCACTATTTTTGG - Intronic
943734761 2:191342152-191342174 TATTCTGAGGCCTCTTTTCTTGG + Intronic
943788523 2:191905889-191905911 AATGCAGATGCTGCTTTTATAGG + Intergenic
944503242 2:200383158-200383180 GATGCTGAGGCCACTCATCTGGG + Intronic
945145552 2:206734452-206734474 GATGCTGATGCTACTGATCTGGG - Intergenic
945350062 2:208766944-208766966 GATGGTGATGCCACTGGTCTTGG - Intronic
945838697 2:214862769-214862791 AATGATGATGGCACTTTGATGGG + Intergenic
946108716 2:217395164-217395186 AAGGCTGATGTCACTTCTCTAGG + Intronic
946938449 2:224746129-224746151 GATGCTGATGCTCCTGTTCTAGG - Intergenic
947531990 2:230915132-230915154 GATGCTGATGCCACTCTCTTTGG - Intronic
948222372 2:236282015-236282037 AATGATGATGGCATTTTTGTGGG - Intergenic
1168853675 20:993758-993780 TATGCAGTTGCCATTTTTCTAGG - Intronic
1169367462 20:5002330-5002352 GATGCTGATGCTACTGGTCTGGG + Intronic
1169619607 20:7490988-7491010 GATGCTGATGCTACTGATCTGGG - Intergenic
1169967609 20:11235324-11235346 AAAACTGATGCCACTTTCCCAGG - Intergenic
1172943371 20:38669931-38669953 AATTCTTATGCCACTCTTCCTGG - Intergenic
1173158616 20:40636060-40636082 AATGCTGATGCTGCTGGTCTGGG + Intergenic
1173823126 20:46031187-46031209 CACACTGATGCCTCTTTTCTAGG - Intronic
1174732843 20:52934982-52935004 GATGCTGATGCCACTAGACTGGG + Intergenic
1175740273 20:61415137-61415159 AATGCCGATGCCACTAGTGTGGG - Intronic
1177021811 21:15870061-15870083 AATCCTGATGCCACTCCTGTAGG - Exonic
1177373017 21:20231071-20231093 TAAACTTATGCCACTTTTCTAGG - Intergenic
1178666554 21:34552224-34552246 ACAGGTGATGCCACTGTTCTTGG - Intronic
1178785482 21:35649465-35649487 GATGCTCATGCCACTGGTCTGGG - Intronic
1179052043 21:37896562-37896584 GGTGCAGAGGCCACTTTTCTTGG + Intronic
1180148859 21:45937426-45937448 AAGGCTCATGCCCCTTTCCTTGG + Intronic
1181803498 22:25361736-25361758 AATGCTGATGCCACTGTGTGTGG - Exonic
1183670697 22:39270697-39270719 AATGCTGCTGCCTCCTTGCTGGG - Intergenic
1184005059 22:41701620-41701642 AATTCTGAGGCTGCTTTTCTTGG + Intronic
1184437485 22:44488354-44488376 AGTGCTGAAGACAATTTTCTAGG - Intergenic
949328338 3:2892311-2892333 AATGCTGATGCTGCTTGTCTGGG + Intronic
949730189 3:7102165-7102187 AATGCTAAAACCACTTTTTTAGG - Intronic
949984145 3:9526085-9526107 AATCCTGAAGACACTTTGCTAGG + Intronic
950899420 3:16483814-16483836 AATGCTGATGCTGCTGGTCTGGG - Intronic
951116086 3:18863649-18863671 AATGCTGATGCAAAATGTCTTGG + Intergenic
951647354 3:24907343-24907365 AATGCTGATGCCACTGGCCTAGG + Intergenic
951782454 3:26379497-26379519 AATGCTGATGTCACTGGTCTGGG - Intergenic
952433864 3:33252712-33252734 AATCATGTTTCCACTTTTCTTGG + Intergenic
952655503 3:35780667-35780689 GATGCTGATGCTTCTTGTCTGGG - Intronic
952688958 3:36181233-36181255 AATGCTGATACCACTAGTCTAGG + Intergenic
953433081 3:42855541-42855563 ATTGCTGTTGCCACTGTTGTTGG + Intronic
955081928 3:55665770-55665792 AATGCTGATGAGAGTTTGCTGGG + Intronic
955576219 3:60366569-60366591 AATGCTGTTACCACTTATCATGG + Intronic
955661825 3:61307659-61307681 AATGCTGATGCTGCTGGTCTGGG - Intergenic
955954822 3:64278016-64278038 AATCTTGATGCCTCTTTTCTTGG + Intronic
956069248 3:65430179-65430201 AATACTGATGACAATTTTCTGGG - Intronic
956270107 3:67442371-67442393 AATACTGATGCCGCTGTTCCAGG - Intronic
956524346 3:70141095-70141117 AAAGCTGCTTCCACATTTCTAGG + Intergenic
956630435 3:71311821-71311843 AATGATGAGGCAACTTTTCCTGG + Intronic
956716214 3:72082413-72082435 GATGCTGATGCTGCTTGTCTAGG - Intergenic
957822858 3:85400815-85400837 AATGCTGATCTCACTTTCCAGGG + Intronic
957837437 3:85615628-85615650 AATAATGATGACACTTTTCTAGG + Intronic
959022331 3:101201460-101201482 AATGCTGATGCTACTGGTCCAGG + Intergenic
959110588 3:102117596-102117618 AATGTAGATGCCACATGTCTTGG + Intronic
959230137 3:103638303-103638325 AAAGCTCATGCCACATTTCTTGG - Intergenic
960025830 3:113008225-113008247 AAGGCTCAGGCCATTTTTCTGGG - Exonic
960165299 3:114394665-114394687 GATGCTGATGCTACTGGTCTGGG + Intronic
961649386 3:128409922-128409944 AAAGCTGCTGCCAGTTTCCTGGG - Intergenic
962067458 3:131996858-131996880 AATGCTGGTGCAAACTTTCTAGG - Intronic
962469773 3:135695915-135695937 AATGCTGATGCTGCTGGTCTGGG - Intergenic
963103529 3:141626277-141626299 AATGCTGATGCTGCTAGTCTTGG - Intergenic
963204219 3:142615864-142615886 AATGCTAATGCTGCTTGTCTGGG - Intronic
963247363 3:143075321-143075343 GATGCTGATGCCGCTTGTTTAGG - Intergenic
965135088 3:164754586-164754608 ATTGCTGATGCTACTATTCCAGG + Intergenic
966279965 3:178214660-178214682 AATGGTGATGCTGCTTGTCTAGG + Intergenic
968290315 3:197533796-197533818 AATTCTGAAGCTACTTTTGTTGG + Intronic
969156567 4:5216232-5216254 AATGCTGATGCTGCTGGTCTGGG + Intronic
970501166 4:16678586-16678608 ATAGCTGATTCCACATTTCTTGG - Intronic
970662586 4:18302764-18302786 AATGTTGATTCCAACTTTCTTGG + Intergenic
972280702 4:37599446-37599468 CATGCTGATCCCATTTGTCTGGG + Intronic
973298084 4:48549252-48549274 AATTCTGCTGCTGCTTTTCTGGG - Intronic
974300295 4:60056561-60056583 TATGCTGATGCTAATTTTATGGG - Intergenic
975975226 4:80087926-80087948 GATGCTGGTGCCATATTTCTTGG - Intronic
977777147 4:100934541-100934563 CATCCTGAAGCCTCTTTTCTTGG + Intergenic
978504355 4:109440400-109440422 AATGAAGATGCCTCATTTCTAGG - Intronic
979295918 4:119032002-119032024 AATTGTGACACCACTTTTCTTGG - Exonic
979394656 4:120172438-120172460 AATGCAGATTCCACTTTATTAGG + Intergenic
979458370 4:120951867-120951889 TATGCAAAGGCCACTTTTCTGGG - Intergenic
980212312 4:129805286-129805308 AATGTGTATGCCAGTTTTCTTGG + Intergenic
980276426 4:130656991-130657013 AATACAAATGCCATTTTTCTTGG + Intergenic
980898245 4:138880010-138880032 AATGGGGAAGACACTTTTCTGGG - Intergenic
981647312 4:147014837-147014859 AATGTCTATGTCACTTTTCTGGG + Intergenic
983086753 4:163455043-163455065 AATGTTGATGCCTGTTTTTTGGG - Intergenic
983337611 4:166416635-166416657 AATGCTGCTTCCACATTTTTGGG + Intergenic
986136318 5:4982417-4982439 GATGCTGATGTCACTGGTCTGGG - Intergenic
987258573 5:16180599-16180621 AAGGCTGCAGCCACTTTTCCAGG - Intronic
988130941 5:27105515-27105537 TATTCTGATGCCTCTCTTCTGGG - Intronic
989195339 5:38710921-38710943 TATTTTAATGCCACTTTTCTTGG - Intergenic
989580537 5:43028831-43028853 AATGCTAAAGCTAGTTTTCTGGG + Intergenic
989842703 5:46100113-46100135 AATGCTGATACTACTTTATTGGG - Intergenic
990364362 5:55054806-55054828 AACCCTCATGCCCCTTTTCTGGG - Intergenic
990402610 5:55454352-55454374 ATTTCTAATGCCACTCTTCTGGG - Intronic
990795496 5:59535290-59535312 AAGTCTGATGTCATTTTTCTGGG + Intronic
990972291 5:61521931-61521953 AATGCTGTTGACATTTTACTGGG + Intronic
992097101 5:73373014-73373036 GATGCTGATGCTTCTTGTCTGGG + Intergenic
992672659 5:79075610-79075632 AATCCTGATCCCTCTTTTGTAGG - Intronic
993971130 5:94421303-94421325 AAGGCTAAGGCCACTGTTCTGGG - Intronic
995501567 5:112812619-112812641 AATTCAGATGCCACTTTTTCAGG + Intronic
996554614 5:124765369-124765391 AATGGGGATAACACTTTTCTTGG - Intergenic
997035648 5:130188403-130188425 AATGCTGATGAAATTATTCTTGG - Intergenic
997919135 5:137961387-137961409 AATCCAGATGTCACTATTCTGGG + Intronic
998609121 5:143668669-143668691 GATGATGATGCCACTGGTCTGGG + Intergenic
998782193 5:145670149-145670171 GATGCTAATGCCATGTTTCTTGG - Intronic
999305747 5:150518330-150518352 ATTGCAGATGCCTATTTTCTTGG + Intronic
999822630 5:155243288-155243310 AATGATGATGGTACTTTGCTGGG + Intergenic
1000143846 5:158433623-158433645 AGTGCTAGTGCCTCTTTTCTAGG - Intergenic
1001182359 5:169532268-169532290 AATGCAAATGCCTCTTTTCTTGG - Intergenic
1001313933 5:170629647-170629669 AATGCTGATGCCACCCTGCAGGG - Intronic
1009348037 6:62641367-62641389 GATTCTGATCTCACTTTTCTGGG + Intergenic
1009923863 6:70096787-70096809 AATGCTGATGCTGCTGGTCTGGG - Intronic
1010280656 6:74019127-74019149 AGTGCTGAGGCCCCTATTCTAGG + Intergenic
1012771812 6:103447334-103447356 AATGCTGATGCTGCTGTTCTGGG + Intergenic
1014080212 6:117277742-117277764 TATGCTGCTGCTGCTTTTCTAGG - Intergenic
1015391252 6:132684771-132684793 AATGCCTATGCCACTTTATTTGG + Intronic
1015582370 6:134739753-134739775 TATGCTCATGCCAAATTTCTAGG + Intergenic
1017936087 6:159006536-159006558 TATGCTGCTGCTTCTTTTCTTGG - Intergenic
1021091243 7:16485609-16485631 ATTGCTGATGCTACTTCTCCTGG - Intronic
1022219033 7:28293883-28293905 AATGTGGATGCCAGTTCTCTTGG + Intergenic
1022971435 7:35520943-35520965 AATGCTGCTCCCACTCTTGTGGG - Intergenic
1028663908 7:93317667-93317689 AATGTTGATGCAGCTTGTCTAGG + Intronic
1029650447 7:101887645-101887667 AATGCTGATGCCAGTGTCATGGG - Intronic
1030356401 7:108548048-108548070 AATGCTACTGCACCTTTTCTAGG + Intronic
1030623737 7:111820393-111820415 AAGGGTGATGGCACATTTCTTGG + Intronic
1030760357 7:113342523-113342545 AATTCTGCTGTCACATTTCTAGG - Intergenic
1031977810 7:128104851-128104873 GATGCTGATGCTGCTGTTCTGGG - Intergenic
1033301757 7:140192441-140192463 TGTGCTGATGCCACTGGTCTGGG + Intergenic
1033540938 7:142355446-142355468 GTTGCTGATGCCTCATTTCTAGG + Intergenic
1033784474 7:144714174-144714196 TTTTCTGATTCCACTTTTCTGGG + Intronic
1034452586 7:151145117-151145139 AATGCTTATGCCCACTTTCTGGG - Intergenic
1036747913 8:11423325-11423347 AATGCGGAAGCCACTTGTGTAGG - Exonic
1037100736 8:15042292-15042314 TGTGCTGATGCCTCTCTTCTGGG + Intronic
1037602286 8:20407205-20407227 TATTCTGAGGCCTCTTTTCTTGG - Intergenic
1037628077 8:20625553-20625575 ATTGCTGATGACACATTTCTGGG - Intergenic
1040564055 8:48550219-48550241 AGTGCTCCTGCCACTTCTCTTGG + Intergenic
1040626394 8:49154380-49154402 AATGATGATGGCATTTTTATGGG + Intergenic
1040786256 8:51167311-51167333 TATGCTAATGCCACTTTTCTGGG - Intergenic
1041868664 8:62607391-62607413 AAGGCTGATGCACCTTCTCTTGG + Intronic
1042119597 8:65471457-65471479 AATACTGGTTCCACTTTTCATGG - Intergenic
1042930104 8:74004633-74004655 ATTGCTGATGTCATTCTTCTGGG + Intronic
1043587434 8:81785274-81785296 AAACTTGATTCCACTTTTCTTGG - Intergenic
1045679067 8:104639590-104639612 GATGCTGATGCTGCTATTCTGGG - Intronic
1046883483 8:119336928-119336950 AAGGCTGAATCCATTTTTCTTGG - Intergenic
1047064738 8:121268376-121268398 GATGCTGATGCTGCTTGTCTGGG - Intergenic
1047304669 8:123643083-123643105 GATGCTGGTGCCATGTTTCTTGG - Intergenic
1047528595 8:125655465-125655487 AAAGCTGATGCCAAGTCTCTGGG + Intergenic
1047570039 8:126087803-126087825 AATGCTGATGCTGCTGGTCTGGG - Intergenic
1049952548 9:659470-659492 AATGCTGATGCTGCTGTTCTGGG + Intronic
1050249159 9:3725628-3725650 AATGCTGATTCTGCTTATCTGGG - Intergenic
1051693747 9:19745431-19745453 AATGCTGATATTACTTCTCTTGG - Intronic
1051807539 9:21012392-21012414 GATGCTGATGCCACTGGTCTAGG + Intronic
1054814588 9:69462929-69462951 AATGCTGATGCTACTGGTCCAGG + Intronic
1054921388 9:70546245-70546267 AATGTTGATGCTGCTTGTCTGGG - Intronic
1055842533 9:80522480-80522502 TATTCTGAGGCTACTTTTCTTGG - Intergenic
1056006817 9:82281316-82281338 AATGCTGAGGCCAGTTGACTAGG + Intergenic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1056464490 9:86840258-86840280 AATGCTGATGCTGCTGTTCTGGG + Intergenic
1057618848 9:96618439-96618461 AGTGCTGATTCGACTGTTCTTGG - Intronic
1058125573 9:101190501-101190523 AATGCTGATGTGCATTTTCTTGG + Intronic
1058127236 9:101209054-101209076 AATGATGATGCTACTGGTCTGGG - Intronic
1058421109 9:104834472-104834494 AATTCTGAAGCCACTTTATTTGG + Intronic
1058867759 9:109177246-109177268 AATGCTGATGCTGCTAGTCTGGG - Intronic
1059472898 9:114520222-114520244 AATGATGATTCCATTTTTGTAGG - Intergenic
1059522928 9:114960903-114960925 AATGCTGATGCTGCTTATCTAGG + Intergenic
1059642101 9:116227426-116227448 CATGCTGATCCCAATTCTCTAGG - Exonic
1060511172 9:124233831-124233853 AATGCTGATGACAGTTTTATTGG - Intergenic
1061316466 9:129799396-129799418 AAATGTGATGCCACCTTTCTGGG - Intergenic
1062569126 9:137176499-137176521 AAAGCTGCTGCCACAGTTCTTGG - Intronic
1186067208 X:5778783-5778805 TATGCTGATGCCACCTGTCCTGG + Intergenic
1186810982 X:13188155-13188177 AATGCTGATGCCGTTGGTCTGGG + Intergenic
1186815970 X:13238419-13238441 GATGCTGATGCCACTGGACTGGG + Intergenic
1187010866 X:15277937-15277959 CATGCTAATGCCACTATTTTGGG + Intergenic
1188451901 X:30316277-30316299 AATGCTGTTGCCACCTCCCTGGG - Intergenic
1188960145 X:36481516-36481538 CATTCTGATGCCTCTTCTCTTGG + Intergenic
1189563735 X:42217727-42217749 AATGCTGATGCCAAAGGTCTGGG + Intergenic
1190033857 X:47001350-47001372 GATACTGATGCCACTAGTCTGGG + Intronic
1190411255 X:50139342-50139364 AATCCTGCTGCCATTTTTCCAGG - Intergenic
1191831007 X:65416447-65416469 GATGTTGATGCTACTGTTCTGGG - Intronic
1192002755 X:67173115-67173137 AATGATGATAGCACTTTTATGGG - Intergenic
1192108071 X:68335458-68335480 GATGCTGATGCTGTTTTTCTAGG + Intronic
1192150332 X:68708333-68708355 AATGTTGCTGCCTCTTTCCTGGG + Intronic
1193007114 X:76632551-76632573 AATGATGATGGCACTTTCATGGG + Intergenic
1193819387 X:86143806-86143828 AATGCTGATGCCGGTGATCTAGG + Intergenic
1193894268 X:87092683-87092705 AATTCTGAGGCCTCTTCTCTTGG - Intergenic
1194827497 X:98580769-98580791 AATGATGATGGCATTTTTATGGG + Intergenic
1194868587 X:99099531-99099553 ACTGCTGATGACACTTTTTCAGG - Intergenic
1195091114 X:101460028-101460050 AATGCTGATGCTACTGCTCTAGG + Intronic
1196021604 X:110996734-110996756 CATTCTGAGGCCTCTTTTCTTGG - Intronic
1196149749 X:112360201-112360223 AATACTGATTCCATTTCTCTAGG + Intergenic
1196415981 X:115471657-115471679 CATTCTGAGGCCTCTTTTCTTGG - Intergenic
1196632228 X:117954919-117954941 AATGCTCAGGCCAATTTTCTAGG + Intronic
1197039823 X:121923231-121923253 AATGCTGGTGTCCCTCTTCTGGG + Intergenic
1197133190 X:123029922-123029944 AATGCTGCCTCCCCTTTTCTGGG + Intergenic
1197333152 X:125179676-125179698 GATGCTGATGCCACTGGTCCAGG - Intergenic
1197446729 X:126559464-126559486 AATTCTGAGGTCCCTTTTCTTGG + Intergenic
1197759442 X:130017148-130017170 AATTCTGAGGTCACATTTCTGGG - Intronic
1199334454 X:146601620-146601642 AATTCTGAAGCCAATTTGCTTGG + Intergenic
1199385338 X:147216812-147216834 AAAGCTGTTGCCACATTTTTAGG - Intergenic
1200103347 X:153699432-153699454 AAGGCTGATCCCACTTTTCCAGG - Intergenic