ID: 926973397

View in Genome Browser
Species Human (GRCh38)
Location 2:18489188-18489210
Sequence TATTATGAACACTGGGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926973397_926973405 -2 Left 926973397 2:18489188-18489210 CCAAGAGCCCAGTGTTCATAATA No data
Right 926973405 2:18489209-18489231 TATATGGGCTGATGGGCGCAGGG No data
926973397_926973403 -9 Left 926973397 2:18489188-18489210 CCAAGAGCCCAGTGTTCATAATA No data
Right 926973403 2:18489202-18489224 TTCATAATATATGGGCTGATGGG No data
926973397_926973404 -3 Left 926973397 2:18489188-18489210 CCAAGAGCCCAGTGTTCATAATA No data
Right 926973404 2:18489208-18489230 ATATATGGGCTGATGGGCGCAGG No data
926973397_926973402 -10 Left 926973397 2:18489188-18489210 CCAAGAGCCCAGTGTTCATAATA No data
Right 926973402 2:18489201-18489223 GTTCATAATATATGGGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926973397 Original CRISPR TATTATGAACACTGGGCTCT TGG (reversed) Intergenic
No off target data available for this crispr