ID: 926973973

View in Genome Browser
Species Human (GRCh38)
Location 2:18494972-18494994
Sequence CTGGATCACCACATTCAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926973968_926973973 15 Left 926973968 2:18494934-18494956 CCTGTGGGTTTCCTGCCAGGTTA No data
Right 926973973 2:18494972-18494994 CTGGATCACCACATTCAAATGGG No data
926973970_926973973 0 Left 926973970 2:18494949-18494971 CCAGGTTACAGACATATTCAGAA No data
Right 926973973 2:18494972-18494994 CTGGATCACCACATTCAAATGGG No data
926973969_926973973 4 Left 926973969 2:18494945-18494967 CCTGCCAGGTTACAGACATATTC No data
Right 926973973 2:18494972-18494994 CTGGATCACCACATTCAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926973973 Original CRISPR CTGGATCACCACATTCAAAT GGG Intergenic
No off target data available for this crispr