ID: 926979789

View in Genome Browser
Species Human (GRCh38)
Location 2:18556601-18556623
Sequence CTACTTAGGAGTTCTGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926979789_926979791 20 Left 926979789 2:18556601-18556623 CCAGTATCAGAACTCCTAAGTAG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 926979791 2:18556644-18556666 AGATGAAGTCTTTGACACCAAGG 0: 1
1: 0
2: 2
3: 50
4: 464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926979789 Original CRISPR CTACTTAGGAGTTCTGATAC TGG (reversed) Intronic
905575439 1:39040423-39040445 CTACCTAGGACTTCATATACAGG - Intergenic
906151396 1:43589748-43589770 CTACTTGGGAGGGCTGAGACAGG + Intronic
910413681 1:86974074-86974096 GGATTTAGGAGTTCTGAGACAGG - Intronic
913483694 1:119314714-119314736 CTACTGAGGAGTTCTGAGCAGGG + Intergenic
918482029 1:184988928-184988950 TTATTTAGAAGTTCTGAGACTGG - Intergenic
923307103 1:232698473-232698495 CTACTCGGGAGTTCTGAGGCAGG - Intergenic
1064742533 10:18448361-18448383 CTACTCAGGAGCTCTGAGGCAGG + Intronic
1066246930 10:33592780-33592802 CTACTTGGGAGTGCTGAGGCAGG - Intergenic
1069241625 10:66146879-66146901 GTACTTAGGAGATCTGATAGAGG + Intronic
1078671768 11:13371962-13371984 CTACTTAAGCATTCTGACACTGG + Intronic
1080728708 11:34924333-34924355 CTACTTGGGAGGCCTGAAACCGG - Intronic
1082222901 11:49662979-49663001 CTACTTAGGAATTTTGTTAAGGG + Intergenic
1082687984 11:56262812-56262834 CTACTTAAGAGGTCTGAGATGGG - Intergenic
1084856423 11:71990651-71990673 CTACTATGGAGTTCTGGAACGGG + Exonic
1088095445 11:106095012-106095034 CTACTCAGGAGGTCTGAGACAGG + Intronic
1090005294 11:122997123-122997145 CTACTTGGGGGTGCTGAGACAGG - Intergenic
1091350071 11:134886678-134886700 CTACTTAGAAGGACTGATAAAGG - Intergenic
1092995766 12:13949016-13949038 CTGCTGAGGACTTGTGATACAGG - Intronic
1093078715 12:14784880-14784902 TTAATTAGCAGTTCTGATTCTGG - Exonic
1096272339 12:50175249-50175271 CTACTCAGGAGGTCTGAGGCAGG + Intergenic
1098059548 12:66546482-66546504 TTACTTATGATTTTTGATACAGG - Intronic
1101275252 12:103192717-103192739 GTACTTAGGTGCTCTGATGCTGG - Intergenic
1102065059 12:109968024-109968046 CTACATAGGAGTGCTGATAGTGG - Intronic
1107895097 13:44954047-44954069 CTACCTAGTAGTTCTAATGCAGG + Intronic
1108178443 13:47818414-47818436 CTCCTTAGCAGCTCTGATTCTGG + Intergenic
1109523902 13:63549440-63549462 CTACTTAAGATTTCTGATTTTGG - Intergenic
1112109038 13:96274265-96274287 CTGCCTGGGAGTTCTGAAACTGG - Intronic
1114933685 14:27506980-27507002 CAGCTCAGGAGTTATGATACGGG + Intergenic
1115065993 14:29260137-29260159 TTAGTTAAGAATTCTGATACTGG - Intergenic
1115618022 14:35114880-35114902 CTACTTAGGAGGGCTGAGGCAGG + Intronic
1116436684 14:44902437-44902459 CTACTTGGGGGTGCTGAGACAGG - Intronic
1118520606 14:66579677-66579699 GTATTTAGGTGTTCTGATATTGG - Intronic
1120221485 14:81739210-81739232 CTACTTAGCAACTCTGATTCTGG - Intergenic
1120772843 14:88399807-88399829 ATATTTAGGAGTTCTGATGTTGG - Intronic
1124812306 15:32953176-32953198 CCACCTAGGAGATCTGATAATGG + Intronic
1126521453 15:49600074-49600096 ATATTTAGGTGTTCTGACACTGG + Intronic
1133086523 16:3368393-3368415 CTTCTTAGGATTTATCATACGGG - Intronic
1135133209 16:19869571-19869593 CTACCTAGGGGATGTGATACAGG - Intronic
1135250139 16:20894155-20894177 CTACTCAGGAGGGCTGAGACAGG + Intronic
1137453521 16:48599305-48599327 CTCCTTAGGAATTCTGACATAGG - Intronic
1137862474 16:51860411-51860433 CTTCCCAGGAATTCTGATACTGG + Intergenic
1140398273 16:74648053-74648075 CTACTTAGGGAGTCTGAGACAGG - Intronic
1141288341 16:82693571-82693593 CTACTTGGAGGTTCTTATACAGG - Intronic
1146076562 17:29735583-29735605 CTACTTAGGAGGCTTGAGACAGG + Intronic
1148501786 17:48097140-48097162 CTACTTAGGAGGCCTGAGGCAGG + Intronic
1150981387 17:70145994-70146016 TTATTTAGTAGATCTGATACAGG + Intergenic
1156721361 18:40073767-40073789 CTACTCAGGAGGTCTGAGCCTGG + Intergenic
1157369780 18:47100157-47100179 CTACACAGGGCTTCTGATACTGG + Intronic
1157533505 18:48441723-48441745 CTTCTGAGGATTTCTGACACCGG + Intergenic
1159250975 18:65875815-65875837 CTACTTGGGAGTGCTGAGGCAGG + Intronic
1159370577 18:67522870-67522892 CTACTGAGGAAATATGATACTGG - Intergenic
1159696704 18:71566906-71566928 CTACTTGGGAGTTTTGAGGCAGG + Intergenic
926979789 2:18556601-18556623 CTACTTAGGAGTTCTGATACTGG - Intronic
927346392 2:22048073-22048095 CTATTTAGTAGTTCTGATAAAGG + Intergenic
927983366 2:27389635-27389657 AAACTTAGTAGTTCTGATTCAGG - Intronic
927983891 2:27393872-27393894 GTACTCAGGAGTTTTGAGACGGG - Intronic
928482872 2:31700881-31700903 GTATTTAGGAGTTCTGATGATGG - Intergenic
928917318 2:36486328-36486350 ATACCTAGGAGTTCTGCTGCTGG + Intronic
931176314 2:59858552-59858574 CTTCTTATGAGTTCTGAAAGAGG + Intergenic
932069346 2:68601600-68601622 ATACTTAGGAGCTCTGATGTTGG - Intronic
932292192 2:70591206-70591228 CTACTCAGGAGCTCTGACGCAGG + Intergenic
936643270 2:114340597-114340619 CCACTTAGGAGTTCTAAAAATGG - Intergenic
939158652 2:138558047-138558069 CTACTCAGGAGGTCTGAGACAGG + Intronic
940641210 2:156346101-156346123 CTACTTAGAAGTGCTAATAAAGG + Intergenic
941327601 2:164136334-164136356 GAACTTAGGAGTTCAGGTACAGG + Intergenic
941597635 2:167497523-167497545 CTTCTTAGAAGTTCTGCTTCAGG + Intergenic
943675105 2:190709018-190709040 CTTCTTGGGAGTTCTATTACAGG - Intergenic
947188977 2:227481715-227481737 CAAGATAGGAGTTTTGATACAGG + Intronic
947377299 2:229509701-229509723 CTACTTAGGAGGGCTGAAGCAGG + Intronic
948467937 2:238161101-238161123 CTCCTTAGAACTTCTGACACTGG + Intronic
1170179673 20:13515773-13515795 GTACTTAGTATGTCTGATACTGG - Intronic
1177519425 21:22199226-22199248 ATATTTAGGTGTTCTGATATTGG + Intergenic
1179359843 21:40695430-40695452 CTACTAAGGTGTCCTGGTACTGG - Intronic
952841412 3:37649543-37649565 ATACTTAGGTGCTCTGATGCTGG - Intronic
953080270 3:39610126-39610148 CTACTCAGGGGTGCTGAGACAGG - Intergenic
953923412 3:46967526-46967548 CCACCTGGGAGTTCTGAGACGGG - Intronic
955111124 3:55951024-55951046 CTACTTGGGAGCTCTGCCACTGG - Intronic
955258662 3:57361236-57361258 CTACTCAGGAGTCCTGAGGCAGG + Intronic
955849658 3:63206147-63206169 TTACTTAGGCTTTCTGAGACGGG + Intergenic
957141540 3:76365174-76365196 TTACTTTGGAGTACAGATACAGG - Intronic
960850623 3:122049542-122049564 ATACTTAGGTGTTCTGATGTTGG + Intergenic
961253074 3:125522837-125522859 CTACTGAGTAGTTGGGATACAGG - Intergenic
963446525 3:145416526-145416548 ATATTTAGGTGTTCTGATATTGG + Intergenic
966827134 3:183974417-183974439 CTACTCAGGAGGGCTGACACAGG - Intronic
973879349 4:55253545-55253567 CCACTAAGGAGTTGTGATAACGG + Intergenic
974259453 4:59506213-59506235 CTAATTATGATTTTTGATACAGG + Intergenic
975482842 4:74900884-74900906 GTATTTAGGAATGCTGATACGGG + Intergenic
976027597 4:80709541-80709563 CCCCTTAGGAGTTCAGATGCTGG + Intronic
976311688 4:83619606-83619628 CCACTGAAGAGTTCTGATAGTGG - Intergenic
976468415 4:85398415-85398437 CTAGTGAGGATTTCTGTTACTGG - Intergenic
976833613 4:89344942-89344964 ATACTTAGGAGCTCTGATGTTGG + Intergenic
976926020 4:90496864-90496886 CTACTCAGGAGTGCTGAGGCAGG + Intronic
978851381 4:113341124-113341146 ATACTTAGGAGTTCTGGAGCAGG + Intronic
979537680 4:121842139-121842161 CTACTTGGGAGTCTTGAGACAGG + Intronic
982498071 4:156116517-156116539 CTCCTCAGGAGTTCTAATTCAGG + Intergenic
989010889 5:36871574-36871596 CTATTTTAGAGATCTGATACTGG - Intergenic
989062363 5:37421994-37422016 CTACTTCTTAGTTCTGTTACAGG + Intronic
993978873 5:94516987-94517009 CTACTTAGGAGGCCTGAGGCAGG + Intronic
994003233 5:94806027-94806049 CTTCTTAGGTGTTCTGGTAGAGG + Intronic
994176283 5:96714933-96714955 CTGATTATGAGCTCTGATACCGG - Intronic
996781859 5:127195953-127195975 ATATTTAGGTGTTCTGATGCTGG - Intergenic
1000413923 5:160963659-160963681 GTACTCTGGAGTTCTAATACTGG + Intergenic
1007519585 6:42441295-42441317 CTACGTAAGATTTCTGATAGAGG - Intronic
1012506633 6:99954204-99954226 CTACTTACTAGCTCTGATGCTGG + Intronic
1013002401 6:106036923-106036945 CTACTTGGGAGTGCTGAGGCAGG - Intergenic
1016945477 6:149528739-149528761 ATACCTAGGAGTTCAGATGCTGG - Intronic
1020202630 7:6092287-6092309 CTACTCAGGAGGTCTGAGGCAGG - Intergenic
1021326605 7:19277843-19277865 ATACTTAGGTGTTCTGATGTTGG + Intergenic
1023571144 7:41573275-41573297 CCACTTGGGAATTCTGCTACAGG - Intergenic
1023772438 7:43570365-43570387 CTACATAGGAGTTCTAATCCAGG - Intergenic
1030719920 7:112858786-112858808 ATAAATAGAAGTTCTGATACTGG - Intronic
1031360431 7:120843428-120843450 GTACTTAGGAGTTTGGATTCTGG - Intronic
1032887113 7:136152461-136152483 CTACTTGGGAGTACTGAGTCAGG + Intergenic
1034114519 7:148571902-148571924 ATTCATATGAGTTCTGATACAGG + Intergenic
1040545504 8:48395675-48395697 CTACTCAGGAGGTCTGAGGCAGG + Intergenic
1042273501 8:66979422-66979444 CTACTTGGGAGTTCTGAGGTAGG + Intronic
1042546192 8:69953775-69953797 CTACAGAGAAGTTCTGATAAAGG + Intergenic
1044025438 8:87165420-87165442 ATACTTAGGTGTTCTGATGTTGG + Intronic
1061376848 9:130231238-130231260 CTACTTAGGGGTGCTGAGGCAGG + Intronic
1062542366 9:137047256-137047278 CAGCTTTGGAGTTCTGAGACTGG - Intergenic
1186472654 X:9833502-9833524 CTAATTAGGAGGTCCGATGCAGG - Intronic
1187457906 X:19459000-19459022 CTACTGGAGAGTTCTGAGACTGG - Intronic
1188070893 X:25716786-25716808 TGACTTAGGAGGTCTGATGCAGG + Intergenic
1188278487 X:28232886-28232908 CTACTGGGCAGTTCTGATCCTGG + Intergenic
1188376499 X:29436348-29436370 TTTCTTAGGAATTCTGCTACTGG + Intronic
1194989678 X:100533706-100533728 ATATTTAGGTGCTCTGATACTGG + Intergenic
1196011546 X:110893183-110893205 TTAAATAGGACTTCTGATACTGG + Intergenic
1196883445 X:120221273-120221295 CTACTCGGGAGTTCTGAGGCAGG + Intergenic
1199011041 X:142759239-142759261 CTATATAGGAGGTGTGATACTGG - Intergenic