ID: 926983333

View in Genome Browser
Species Human (GRCh38)
Location 2:18594817-18594839
Sequence AAGCTGATCTAAGTGACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926983333_926983337 27 Left 926983333 2:18594817-18594839 CCACCTGTCACTTAGATCAGCTT No data
Right 926983337 2:18594867-18594889 ACAAATTACTACTAACTTACTGG No data
926983333_926983335 -3 Left 926983333 2:18594817-18594839 CCACCTGTCACTTAGATCAGCTT No data
Right 926983335 2:18594837-18594859 CTTGCTGTATTAATTTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926983333 Original CRISPR AAGCTGATCTAAGTGACAGG TGG (reversed) Intergenic
No off target data available for this crispr