ID: 926983337

View in Genome Browser
Species Human (GRCh38)
Location 2:18594867-18594889
Sequence ACAAATTACTACTAACTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926983334_926983337 24 Left 926983334 2:18594820-18594842 CCTGTCACTTAGATCAGCTTGCT No data
Right 926983337 2:18594867-18594889 ACAAATTACTACTAACTTACTGG No data
926983333_926983337 27 Left 926983333 2:18594817-18594839 CCACCTGTCACTTAGATCAGCTT No data
Right 926983337 2:18594867-18594889 ACAAATTACTACTAACTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926983337 Original CRISPR ACAAATTACTACTAACTTAC TGG Intergenic
No off target data available for this crispr