ID: 926985070

View in Genome Browser
Species Human (GRCh38)
Location 2:18613607-18613629
Sequence CCCAGTATACATCTTGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926985070_926985084 23 Left 926985070 2:18613607-18613629 CCCTCACCAAGATGTATACTGGG No data
Right 926985084 2:18613653-18613675 AGACCAAAAAGGGGGAGGAAGGG No data
926985070_926985083 22 Left 926985070 2:18613607-18613629 CCCTCACCAAGATGTATACTGGG No data
Right 926985083 2:18613652-18613674 TAGACCAAAAAGGGGGAGGAAGG No data
926985070_926985077 -7 Left 926985070 2:18613607-18613629 CCCTCACCAAGATGTATACTGGG No data
Right 926985077 2:18613623-18613645 TACTGGGGGTCTTTTCTTGAGGG No data
926985070_926985076 -8 Left 926985070 2:18613607-18613629 CCCTCACCAAGATGTATACTGGG No data
Right 926985076 2:18613622-18613644 ATACTGGGGGTCTTTTCTTGAGG No data
926985070_926985082 18 Left 926985070 2:18613607-18613629 CCCTCACCAAGATGTATACTGGG No data
Right 926985082 2:18613648-18613670 TGAATAGACCAAAAAGGGGGAGG No data
926985070_926985081 15 Left 926985070 2:18613607-18613629 CCCTCACCAAGATGTATACTGGG No data
Right 926985081 2:18613645-18613667 GTCTGAATAGACCAAAAAGGGGG No data
926985070_926985079 13 Left 926985070 2:18613607-18613629 CCCTCACCAAGATGTATACTGGG No data
Right 926985079 2:18613643-18613665 GGGTCTGAATAGACCAAAAAGGG No data
926985070_926985080 14 Left 926985070 2:18613607-18613629 CCCTCACCAAGATGTATACTGGG No data
Right 926985080 2:18613644-18613666 GGTCTGAATAGACCAAAAAGGGG No data
926985070_926985078 12 Left 926985070 2:18613607-18613629 CCCTCACCAAGATGTATACTGGG No data
Right 926985078 2:18613642-18613664 AGGGTCTGAATAGACCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926985070 Original CRISPR CCCAGTATACATCTTGGTGA GGG (reversed) Intergenic
No off target data available for this crispr