ID: 926985075

View in Genome Browser
Species Human (GRCh38)
Location 2:18613613-18613635
Sequence AAGACCCCCAGTATACATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926985075_926985078 6 Left 926985075 2:18613613-18613635 CCAAGATGTATACTGGGGGTCTT No data
Right 926985078 2:18613642-18613664 AGGGTCTGAATAGACCAAAAAGG No data
926985075_926985079 7 Left 926985075 2:18613613-18613635 CCAAGATGTATACTGGGGGTCTT No data
Right 926985079 2:18613643-18613665 GGGTCTGAATAGACCAAAAAGGG No data
926985075_926985082 12 Left 926985075 2:18613613-18613635 CCAAGATGTATACTGGGGGTCTT No data
Right 926985082 2:18613648-18613670 TGAATAGACCAAAAAGGGGGAGG No data
926985075_926985080 8 Left 926985075 2:18613613-18613635 CCAAGATGTATACTGGGGGTCTT No data
Right 926985080 2:18613644-18613666 GGTCTGAATAGACCAAAAAGGGG No data
926985075_926985083 16 Left 926985075 2:18613613-18613635 CCAAGATGTATACTGGGGGTCTT No data
Right 926985083 2:18613652-18613674 TAGACCAAAAAGGGGGAGGAAGG No data
926985075_926985081 9 Left 926985075 2:18613613-18613635 CCAAGATGTATACTGGGGGTCTT No data
Right 926985081 2:18613645-18613667 GTCTGAATAGACCAAAAAGGGGG No data
926985075_926985084 17 Left 926985075 2:18613613-18613635 CCAAGATGTATACTGGGGGTCTT No data
Right 926985084 2:18613653-18613675 AGACCAAAAAGGGGGAGGAAGGG No data
926985075_926985086 25 Left 926985075 2:18613613-18613635 CCAAGATGTATACTGGGGGTCTT No data
Right 926985086 2:18613661-18613683 AAGGGGGAGGAAGGGTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926985075 Original CRISPR AAGACCCCCAGTATACATCT TGG (reversed) Intergenic
No off target data available for this crispr