ID: 926985077

View in Genome Browser
Species Human (GRCh38)
Location 2:18613623-18613645
Sequence TACTGGGGGTCTTTTCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926985070_926985077 -7 Left 926985070 2:18613607-18613629 CCCTCACCAAGATGTATACTGGG No data
Right 926985077 2:18613623-18613645 TACTGGGGGTCTTTTCTTGAGGG No data
926985072_926985077 -8 Left 926985072 2:18613608-18613630 CCTCACCAAGATGTATACTGGGG No data
Right 926985077 2:18613623-18613645 TACTGGGGGTCTTTTCTTGAGGG No data
926985068_926985077 -4 Left 926985068 2:18613604-18613626 CCACCCTCACCAAGATGTATACT No data
Right 926985077 2:18613623-18613645 TACTGGGGGTCTTTTCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926985077 Original CRISPR TACTGGGGGTCTTTTCTTGA GGG Intergenic
No off target data available for this crispr