ID: 926985084

View in Genome Browser
Species Human (GRCh38)
Location 2:18613653-18613675
Sequence AGACCAAAAAGGGGGAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926985075_926985084 17 Left 926985075 2:18613613-18613635 CCAAGATGTATACTGGGGGTCTT No data
Right 926985084 2:18613653-18613675 AGACCAAAAAGGGGGAGGAAGGG No data
926985070_926985084 23 Left 926985070 2:18613607-18613629 CCCTCACCAAGATGTATACTGGG No data
Right 926985084 2:18613653-18613675 AGACCAAAAAGGGGGAGGAAGGG No data
926985068_926985084 26 Left 926985068 2:18613604-18613626 CCACCCTCACCAAGATGTATACT No data
Right 926985084 2:18613653-18613675 AGACCAAAAAGGGGGAGGAAGGG No data
926985072_926985084 22 Left 926985072 2:18613608-18613630 CCTCACCAAGATGTATACTGGGG No data
Right 926985084 2:18613653-18613675 AGACCAAAAAGGGGGAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926985084 Original CRISPR AGACCAAAAAGGGGGAGGAA GGG Intergenic
No off target data available for this crispr