ID: 926987422

View in Genome Browser
Species Human (GRCh38)
Location 2:18639751-18639773
Sequence TGTCAGCTGTAGAACGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926987415_926987422 14 Left 926987415 2:18639714-18639736 CCCCCAGGCACTCTCTTTCAGGG No data
Right 926987422 2:18639751-18639773 TGTCAGCTGTAGAACGTGGGTGG No data
926987412_926987422 24 Left 926987412 2:18639704-18639726 CCTGACCTGACCCCCAGGCACTC No data
Right 926987422 2:18639751-18639773 TGTCAGCTGTAGAACGTGGGTGG No data
926987410_926987422 29 Left 926987410 2:18639699-18639721 CCTGGCCTGACCTGACCCCCAGG No data
Right 926987422 2:18639751-18639773 TGTCAGCTGTAGAACGTGGGTGG No data
926987417_926987422 13 Left 926987417 2:18639715-18639737 CCCCAGGCACTCTCTTTCAGGGA No data
Right 926987422 2:18639751-18639773 TGTCAGCTGTAGAACGTGGGTGG No data
926987418_926987422 12 Left 926987418 2:18639716-18639738 CCCAGGCACTCTCTTTCAGGGAG No data
Right 926987422 2:18639751-18639773 TGTCAGCTGTAGAACGTGGGTGG No data
926987413_926987422 19 Left 926987413 2:18639709-18639731 CCTGACCCCCAGGCACTCTCTTT No data
Right 926987422 2:18639751-18639773 TGTCAGCTGTAGAACGTGGGTGG No data
926987419_926987422 11 Left 926987419 2:18639717-18639739 CCAGGCACTCTCTTTCAGGGAGA No data
Right 926987422 2:18639751-18639773 TGTCAGCTGTAGAACGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926987422 Original CRISPR TGTCAGCTGTAGAACGTGGG TGG Intergenic
No off target data available for this crispr