ID: 926988925

View in Genome Browser
Species Human (GRCh38)
Location 2:18655789-18655811
Sequence AACTCTCCTTAGGACCACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926988925_926988927 -3 Left 926988925 2:18655789-18655811 CCTATGTGGTCCTAAGGAGAGTT No data
Right 926988927 2:18655809-18655831 GTTCTGTACATGCGCTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926988925 Original CRISPR AACTCTCCTTAGGACCACAT AGG (reversed) Intergenic
No off target data available for this crispr