ID: 926990361

View in Genome Browser
Species Human (GRCh38)
Location 2:18673097-18673119
Sequence ACAAGCAGTGAGATTGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926990361_926990364 23 Left 926990361 2:18673097-18673119 CCTGAGTCAATCTCACTGCTTGT No data
Right 926990364 2:18673143-18673165 TTATTTCTGATTCAAGTTAAGGG No data
926990361_926990365 24 Left 926990361 2:18673097-18673119 CCTGAGTCAATCTCACTGCTTGT No data
Right 926990365 2:18673144-18673166 TATTTCTGATTCAAGTTAAGGGG No data
926990361_926990366 25 Left 926990361 2:18673097-18673119 CCTGAGTCAATCTCACTGCTTGT No data
Right 926990366 2:18673145-18673167 ATTTCTGATTCAAGTTAAGGGGG No data
926990361_926990363 22 Left 926990361 2:18673097-18673119 CCTGAGTCAATCTCACTGCTTGT No data
Right 926990363 2:18673142-18673164 TTTATTTCTGATTCAAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926990361 Original CRISPR ACAAGCAGTGAGATTGACTC AGG (reversed) Intergenic
No off target data available for this crispr