ID: 926995856

View in Genome Browser
Species Human (GRCh38)
Location 2:18735193-18735215
Sequence ATTTTCTTCTAGGAGTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24006
Summary {0: 9, 1: 140, 2: 1479, 3: 15880, 4: 6498}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926995856_926995861 8 Left 926995856 2:18735193-18735215 CCATAAAACTCCTAGAAGAAAAT 0: 9
1: 140
2: 1479
3: 15880
4: 6498
Right 926995861 2:18735224-18735246 TACCATTCAGGACATAGGCATGG 0: 13524
1: 7516
2: 2647
3: 1163
4: 728
926995856_926995860 3 Left 926995856 2:18735193-18735215 CCATAAAACTCCTAGAAGAAAAT 0: 9
1: 140
2: 1479
3: 15880
4: 6498
Right 926995860 2:18735219-18735241 GGCAATACCATTCAGGACATAGG 0: 8681
1: 11646
2: 4690
3: 2246
4: 1617
926995856_926995859 -4 Left 926995856 2:18735193-18735215 CCATAAAACTCCTAGAAGAAAAT 0: 9
1: 140
2: 1479
3: 15880
4: 6498
Right 926995859 2:18735212-18735234 AAATTTAGGCAATACCATTCAGG 0: 13
1: 969
2: 10107
3: 11739
4: 4694
926995856_926995862 9 Left 926995856 2:18735193-18735215 CCATAAAACTCCTAGAAGAAAAT 0: 9
1: 140
2: 1479
3: 15880
4: 6498
Right 926995862 2:18735225-18735247 ACCATTCAGGACATAGGCATGGG 0: 13071
1: 7716
2: 3011
3: 1777
4: 1863

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926995856 Original CRISPR ATTTTCTTCTAGGAGTTTTA TGG (reversed) Intergenic
Too many off-targets to display for this crispr