ID: 926997558

View in Genome Browser
Species Human (GRCh38)
Location 2:18753144-18753166
Sequence CACAAGAGTGTGCATCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926997556_926997558 6 Left 926997556 2:18753115-18753137 CCAACTCAAAATGAAGTGGAAGA No data
Right 926997558 2:18753144-18753166 CACAAGAGTGTGCATCAGTCAGG No data
926997553_926997558 25 Left 926997553 2:18753096-18753118 CCAAAGCAAATCGCTTAGCCCAA No data
Right 926997558 2:18753144-18753166 CACAAGAGTGTGCATCAGTCAGG No data
926997555_926997558 7 Left 926997555 2:18753114-18753136 CCCAACTCAAAATGAAGTGGAAG No data
Right 926997558 2:18753144-18753166 CACAAGAGTGTGCATCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926997558 Original CRISPR CACAAGAGTGTGCATCAGTC AGG Intergenic
No off target data available for this crispr