ID: 926998250

View in Genome Browser
Species Human (GRCh38)
Location 2:18763017-18763039
Sequence CACTGTGACCAAAGATTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926998250_926998253 27 Left 926998250 2:18763017-18763039 CCAACTAATCTTTGGTCACAGTG No data
Right 926998253 2:18763067-18763089 TGATTGCTTATATTTCCAATTGG No data
926998250_926998252 -8 Left 926998250 2:18763017-18763039 CCAACTAATCTTTGGTCACAGTG No data
Right 926998252 2:18763032-18763054 TCACAGTGCATTTCAGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926998250 Original CRISPR CACTGTGACCAAAGATTAGT TGG (reversed) Intergenic
No off target data available for this crispr