ID: 927000870

View in Genome Browser
Species Human (GRCh38)
Location 2:18792919-18792941
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927000870_927000874 18 Left 927000870 2:18792919-18792941 CCTAGAAAGGGAGCTGCTCTGCC No data
Right 927000874 2:18792960-18792982 CACACACACACACCCCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927000870 Original CRISPR GGCAGAGCAGCTCCCTTTCT AGG (reversed) Intergenic
No off target data available for this crispr