ID: 927000873 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:18792942-18792964 |
Sequence | GTGTGTGCACGCGCGCGCAG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
927000873_927000874 | -5 | Left | 927000873 | 2:18792942-18792964 | CCACTGCGCGCGCGTGCACACAC | No data | ||
Right | 927000874 | 2:18792960-18792982 | CACACACACACACCCCATGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
927000873 | Original CRISPR | GTGTGTGCACGCGCGCGCAG TGG (reversed) | Intergenic | ||