ID: 927000874

View in Genome Browser
Species Human (GRCh38)
Location 2:18792960-18792982
Sequence CACACACACACACCCCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927000872_927000874 -4 Left 927000872 2:18792941-18792963 CCCACTGCGCGCGCGTGCACACA No data
Right 927000874 2:18792960-18792982 CACACACACACACCCCATGCAGG No data
927000868_927000874 24 Left 927000868 2:18792913-18792935 CCAGACCCTAGAAAGGGAGCTGC No data
Right 927000874 2:18792960-18792982 CACACACACACACCCCATGCAGG No data
927000867_927000874 25 Left 927000867 2:18792912-18792934 CCCAGACCCTAGAAAGGGAGCTG No data
Right 927000874 2:18792960-18792982 CACACACACACACCCCATGCAGG No data
927000871_927000874 -3 Left 927000871 2:18792940-18792962 CCCCACTGCGCGCGCGTGCACAC No data
Right 927000874 2:18792960-18792982 CACACACACACACCCCATGCAGG No data
927000873_927000874 -5 Left 927000873 2:18792942-18792964 CCACTGCGCGCGCGTGCACACAC No data
Right 927000874 2:18792960-18792982 CACACACACACACCCCATGCAGG No data
927000869_927000874 19 Left 927000869 2:18792918-18792940 CCCTAGAAAGGGAGCTGCTCTGC No data
Right 927000874 2:18792960-18792982 CACACACACACACCCCATGCAGG No data
927000870_927000874 18 Left 927000870 2:18792919-18792941 CCTAGAAAGGGAGCTGCTCTGCC No data
Right 927000874 2:18792960-18792982 CACACACACACACCCCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927000874 Original CRISPR CACACACACACACCCCATGC AGG Intergenic
No off target data available for this crispr