ID: 927004284

View in Genome Browser
Species Human (GRCh38)
Location 2:18831958-18831980
Sequence ATGCTGTGCTATAGCACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927004284_927004286 -10 Left 927004284 2:18831958-18831980 CCTTCTGTGCTATAGCACAGCAT No data
Right 927004286 2:18831971-18831993 AGCACAGCATGCACTTTACAGGG No data
927004284_927004288 12 Left 927004284 2:18831958-18831980 CCTTCTGTGCTATAGCACAGCAT No data
Right 927004288 2:18831993-18832015 GAGGATTTGCAAGTTGTTTAAGG No data
927004284_927004287 -7 Left 927004284 2:18831958-18831980 CCTTCTGTGCTATAGCACAGCAT No data
Right 927004287 2:18831974-18831996 ACAGCATGCACTTTACAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927004284 Original CRISPR ATGCTGTGCTATAGCACAGA AGG (reversed) Intergenic
No off target data available for this crispr