ID: 927005653

View in Genome Browser
Species Human (GRCh38)
Location 2:18845449-18845471
Sequence TCATATGGGCAGAAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927005653_927005658 23 Left 927005653 2:18845449-18845471 CCCTCCACTTTCTGCCCATATGA No data
Right 927005658 2:18845495-18845517 GAGCACAGAACCTCAGAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927005653 Original CRISPR TCATATGGGCAGAAAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr