ID: 927005658

View in Genome Browser
Species Human (GRCh38)
Location 2:18845495-18845517
Sequence GAGCACAGAACCTCAGAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927005656_927005658 9 Left 927005656 2:18845463-18845485 CCCATATGAATGCATGAGTTACA No data
Right 927005658 2:18845495-18845517 GAGCACAGAACCTCAGAGCGAGG No data
927005653_927005658 23 Left 927005653 2:18845449-18845471 CCCTCCACTTTCTGCCCATATGA No data
Right 927005658 2:18845495-18845517 GAGCACAGAACCTCAGAGCGAGG No data
927005657_927005658 8 Left 927005657 2:18845464-18845486 CCATATGAATGCATGAGTTACAG No data
Right 927005658 2:18845495-18845517 GAGCACAGAACCTCAGAGCGAGG No data
927005655_927005658 19 Left 927005655 2:18845453-18845475 CCACTTTCTGCCCATATGAATGC No data
Right 927005658 2:18845495-18845517 GAGCACAGAACCTCAGAGCGAGG No data
927005654_927005658 22 Left 927005654 2:18845450-18845472 CCTCCACTTTCTGCCCATATGAA No data
Right 927005658 2:18845495-18845517 GAGCACAGAACCTCAGAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927005658 Original CRISPR GAGCACAGAACCTCAGAGCG AGG Intergenic
No off target data available for this crispr