ID: 927007790

View in Genome Browser
Species Human (GRCh38)
Location 2:18868141-18868163
Sequence AATTTCCTTTAGAAGTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927007787_927007790 25 Left 927007787 2:18868093-18868115 CCTATCATATAAAGAAAGCAGTG No data
Right 927007790 2:18868141-18868163 AATTTCCTTTAGAAGTCTGATGG No data
927007786_927007790 28 Left 927007786 2:18868090-18868112 CCTCCTATCATATAAAGAAAGCA No data
Right 927007790 2:18868141-18868163 AATTTCCTTTAGAAGTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927007790 Original CRISPR AATTTCCTTTAGAAGTCTGA TGG Intergenic
No off target data available for this crispr