ID: 927008714

View in Genome Browser
Species Human (GRCh38)
Location 2:18879693-18879715
Sequence ACTTATCTGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927008714_927008721 25 Left 927008714 2:18879693-18879715 CCTGCCATCTTCTGCAGATAAGT No data
Right 927008721 2:18879741-18879763 GGCCTGTTACTGGGCTTTGGTGG 0: 144
1: 161
2: 86
3: 68
4: 218
927008714_927008716 4 Left 927008714 2:18879693-18879715 CCTGCCATCTTCTGCAGATAAGT No data
Right 927008716 2:18879720-18879742 TCCTTTTGACAGACAGCTCTTGG No data
927008714_927008718 15 Left 927008714 2:18879693-18879715 CCTGCCATCTTCTGCAGATAAGT No data
Right 927008718 2:18879731-18879753 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
927008714_927008720 22 Left 927008714 2:18879693-18879715 CCTGCCATCTTCTGCAGATAAGT No data
Right 927008720 2:18879738-18879760 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
927008714_927008719 16 Left 927008714 2:18879693-18879715 CCTGCCATCTTCTGCAGATAAGT No data
Right 927008719 2:18879732-18879754 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927008714 Original CRISPR ACTTATCTGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr