ID: 927012144

View in Genome Browser
Species Human (GRCh38)
Location 2:18914948-18914970
Sequence GAGGGTGAAAGAAGTGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927012139_927012144 5 Left 927012139 2:18914920-18914942 CCTAGAACTATTAGGATTGCTCC No data
Right 927012144 2:18914948-18914970 GAGGGTGAAAGAAGTGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927012144 Original CRISPR GAGGGTGAAAGAAGTGCGGA AGG Intergenic
No off target data available for this crispr