ID: 927016400

View in Genome Browser
Species Human (GRCh38)
Location 2:18966988-18967010
Sequence CATGTAGGATAGTTGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927016396_927016400 7 Left 927016396 2:18966958-18966980 CCAGTATCATGCTGTTTTGGTTA 0: 546
1: 14328
2: 9245
3: 6050
4: 4258
Right 927016400 2:18966988-18967010 CATGTAGGATAGTTGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927016400 Original CRISPR CATGTAGGATAGTTGGAAGT AGG Intergenic
No off target data available for this crispr