ID: 927021568

View in Genome Browser
Species Human (GRCh38)
Location 2:19022386-19022408
Sequence AATCCAGGTGTTGTTCTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927021562_927021568 30 Left 927021562 2:19022333-19022355 CCTTGCGTATGACTGTAAGGTTG 0: 1
1: 0
2: 0
3: 2
4: 56
Right 927021568 2:19022386-19022408 AATCCAGGTGTTGTTCTTTGAGG 0: 1
1: 0
2: 1
3: 12
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927021568 Original CRISPR AATCCAGGTGTTGTTCTTTG AGG Intergenic
903663149 1:24990972-24990994 AATCCAGATGTTGTTTTTGAAGG + Intergenic
903736091 1:25530699-25530721 GATGCGGGTGTTGTTCTTTCTGG - Intergenic
911635441 1:100230098-100230120 ACTCCAATTTTTGTTCTTTGTGG + Intronic
912794039 1:112679935-112679957 GACCCAGGTGTTGTACTTTAAGG + Intronic
913030882 1:114901811-114901833 AAACCAGGTTTTTTTCTTTTTGG - Intronic
916270889 1:162940234-162940256 GACTCAGGTGTAGTTCTTTGTGG - Intergenic
916320047 1:163494222-163494244 ACTACAGGTTTTTTTCTTTGTGG - Intergenic
918854198 1:189729728-189729750 ATTCCAGGTGGTGCTATTTGGGG - Intergenic
1063216034 10:3926427-3926449 ACTGTTGGTGTTGTTCTTTGTGG + Intergenic
1065224265 10:23526925-23526947 AATCCATGTGTAGGTTTTTGTGG + Intergenic
1066009984 10:31185920-31185942 AATCTTGGTGTAGTACTTTGTGG - Intergenic
1067406321 10:46026906-46026928 AATCAAGATGTTCCTCTTTGGGG - Intronic
1069563175 10:69445629-69445651 AATCCAGGTGCAGTTGTCTGGGG - Intergenic
1069642058 10:69962511-69962533 ACTCCAAGTTTTGTTATTTGGGG - Intronic
1070443811 10:76474408-76474430 ACTCCTGATGATGTTCTTTGAGG - Intronic
1070724753 10:78780353-78780375 AAGCCAGGTCTTGGTCCTTGTGG - Intergenic
1071815945 10:89232850-89232872 AATCCAGGAGTTATTTATTGGGG - Intronic
1071817161 10:89243962-89243984 TATACAGGGGTTATTCTTTGGGG + Intronic
1073632198 10:105160211-105160233 TAGCCAGGCATTGTTCTTTGTGG + Intronic
1073965164 10:108980427-108980449 AATTCATGTGTAGTTCTTAGGGG - Intergenic
1075227897 10:120646089-120646111 AATCCAGGGGTGGTCTTTTGAGG + Intergenic
1075866761 10:125729053-125729075 TAATCAGGTTTTGTTCTTTGGGG - Exonic
1076795591 10:132796674-132796696 ATTCCAGGTGTTCTTATTTGGGG - Intergenic
1076800477 10:132825765-132825787 TATCTGGGTTTTGTTCTTTGAGG - Intronic
1079927236 11:26509764-26509786 ATTCCAGGAGATGTTCTGTGGGG - Intronic
1082774289 11:57234035-57234057 ATTCCGGGTTTTGTTCTTGGAGG - Exonic
1085567997 11:77532216-77532238 AATCCTTGTTTTTTTCTTTGTGG + Intronic
1088788041 11:113200437-113200459 AATCCAAGGGTTGTTACTTGGGG + Intronic
1089016215 11:115167484-115167506 AATGCAGTTGCTTTTCTTTGGGG - Intergenic
1094425524 12:30313219-30313241 AATCCAGGAGCTGTTTTTTTGGG + Intergenic
1096363151 12:51005761-51005783 AAGCCAGGTGTGGTGCTGTGTGG + Intronic
1098948846 12:76618267-76618289 ACTTCACGTGATGTTCTTTGTGG - Intergenic
1099976490 12:89551059-89551081 AACCCAAGTCTTGCTCTTTGTGG + Intergenic
1101523322 12:105504874-105504896 AATCCAAGAGTTCTACTTTGTGG + Intergenic
1103183220 12:118933227-118933249 AATCAAGGTTCTGTCCTTTGAGG + Intergenic
1105358041 13:19678011-19678033 AATTCAGTTGATGTTCTTTGAGG - Intronic
1105462099 13:20601683-20601705 AATCCATGTCTTTTTCTTTTAGG + Exonic
1106206526 13:27601449-27601471 AATGCAGTTGTCTTTCTTTGGGG - Intronic
1108754679 13:53485612-53485634 AATCCAGGTGTTATTTGTTCAGG + Intergenic
1110984293 13:81944482-81944504 AATCCAGGTTATTTTCTTTATGG - Intergenic
1111182907 13:84692486-84692508 AATCCATGTGTTCAGCTTTGAGG + Intergenic
1112309420 13:98304908-98304930 AATTCAAGTGTATTTCTTTGTGG - Intronic
1114589797 14:23851614-23851636 TATCCAGCTGATGTTATTTGAGG + Intergenic
1114753986 14:25237850-25237872 ATTTCAGGTTTTCTTCTTTGTGG + Intergenic
1116372764 14:44156763-44156785 ACTACAGGTTTTATTCTTTGTGG - Intergenic
1116826555 14:49678321-49678343 TGTCCAGGTGTTGCTCTTGGGGG - Intronic
1118110434 14:62712140-62712162 AATCCAAGTGTTACTGTTTGCGG - Intronic
1120077074 14:80171114-80171136 AATTCAGTTGTTCTTCTCTGTGG - Intergenic
1121458939 14:94058574-94058596 GAACCAGATGTTGTTCTCTGTGG - Intronic
1121645112 14:95512992-95513014 AATCAAGGTGATTATCTTTGGGG - Intergenic
1122766356 14:104073818-104073840 AATCCATGAGTTGTTATCTGTGG + Intergenic
1123844153 15:24280281-24280303 AATTCAGGTGCTATTATTTGGGG + Intergenic
1123859236 15:24446564-24446586 AATTCAGGTGCTATTATTTGGGG + Intergenic
1128232816 15:66047562-66047584 ACACCAGGTGTTATTCTTTATGG - Intronic
1130555766 15:84921424-84921446 AATCCAGGTTTTCTTCTTTCTGG + Intronic
1131544144 15:93301833-93301855 AATCCAGGTCATGGACTTTGAGG - Intergenic
1135011107 16:18879662-18879684 AAACCAGGTGTTTTTTTCTGAGG - Exonic
1135318001 16:21467259-21467281 AAACCAGGTGTTTTTTTCTGAGG - Intergenic
1135370896 16:21899054-21899076 AAACCAGGTGTTTTTTTCTGAGG - Intergenic
1135440889 16:22471663-22471685 AAACCAGGTGTTTTTTTCTGAGG + Intergenic
1136314767 16:29446969-29446991 AAACCAGGTGTTTTTTTCTGAGG - Intronic
1136328209 16:29548705-29548727 AAACCAGGTGTTTTTTTCTGAGG - Intergenic
1136442894 16:30288728-30288750 AAACCAGGTGTTTTTTTCTGAGG - Intergenic
1138989518 16:62374443-62374465 AAGCAAGGTCATGTTCTTTGTGG - Intergenic
1139661803 16:68425834-68425856 AACCCAGGTGTTGTTCCTTCTGG - Intronic
1139889641 16:70241203-70241225 AAACCAGGTGTTTTTTTCTGAGG - Intergenic
1140070611 16:71646390-71646412 ATTCCAAATGTTGTTCTGTGTGG - Exonic
1144024109 17:11262404-11262426 TATCCAGGTGTAGTTTCTTGTGG + Intronic
1147532848 17:41296129-41296151 AATCCAGATGCTGTGCTATGAGG + Intergenic
1149980582 17:61308169-61308191 ACTCCTGGTGTTGTTGTTTATGG + Intronic
1151461119 17:74254624-74254646 AATCCAGGTATGGTTTTTTCAGG - Intronic
1152096493 17:78275068-78275090 AATCTGGGTGATGTTCTATGGGG - Intergenic
1152474417 17:80508746-80508768 AATCCAGCTGTGGGCCTTTGAGG - Intergenic
1155942918 18:31817696-31817718 AATTGAGGTGGTGTTCTTTTTGG + Intergenic
1156396330 18:36703335-36703357 AATACAGCTGGTGTTCTGTGCGG + Intronic
1157543997 18:48535131-48535153 CTTTCAGGTGTTGGTCTTTGGGG + Intergenic
1163879923 19:19910200-19910222 AATCCAGGTCTTGAGATTTGGGG + Intronic
1165142442 19:33708755-33708777 ACAGCAGGTGTTGTTCTTTTTGG - Intronic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
926913522 2:17872820-17872842 ATTTCAGCTGTTGTTATTTGTGG - Intergenic
927021568 2:19022386-19022408 AATCCAGGTGTTGTTCTTTGAGG + Intergenic
928662826 2:33520782-33520804 AATCCAGGTTTGCTTCTGTGAGG + Intronic
930613130 2:53565173-53565195 AATCCAAGTCTTGTATTTTGGGG - Intronic
933577344 2:84084307-84084329 AATCCAATTGTTGAACTTTGAGG + Intergenic
933702393 2:85264742-85264764 AATCCAGGGCTTGGTCTTTATGG - Intronic
936483670 2:112908115-112908137 CATCCAGGAGTTGTTTTATGAGG - Intergenic
938805837 2:134806570-134806592 ATTCCAGGTGCTACTCTTTGAGG - Intergenic
939780221 2:146437118-146437140 TATCCATGTTCTGTTCTTTGGGG - Intergenic
940616777 2:156058613-156058635 AATGCAAGTGTTGTTCTGTTAGG - Intergenic
940825790 2:158410519-158410541 ATTATAGGTGTTTTTCTTTGTGG + Intronic
941279095 2:163527579-163527601 ACTCCAGGTTTAGTTTTTTGAGG - Intergenic
941893990 2:170611400-170611422 ATTCCAGGGGCTGGTCTTTGGGG - Intronic
945129004 2:206545873-206545895 AATCTGTGTTTTGTTCTTTGTGG - Intronic
945145869 2:206737289-206737311 CATCCAGCTCTTGTTCTCTGTGG + Intergenic
947789746 2:232858138-232858160 ATTCCAGGTGATGTTCTGTAGGG - Exonic
948857252 2:240735848-240735870 AATCCGGGGGGTGTTCTATGTGG - Intronic
1168865721 20:1084802-1084824 AATCCAGGAGTTGATTTTGGAGG - Intergenic
1170958083 20:21000185-21000207 AATATAGCTGTTGTTCTTAGAGG - Intergenic
1171293861 20:23999472-23999494 ACTCCAGGTATTATTCCTTGGGG - Intergenic
1173802811 20:45905225-45905247 AACCCAGCTGCTGTTCTTGGAGG + Intronic
1174106606 20:48166625-48166647 AGACCAGGTTTTGGTCTTTGTGG - Intergenic
1180133602 21:45845067-45845089 AATCCAGGTATGGTCCTTTTAGG - Intronic
1180987169 22:19911844-19911866 AACCCAGGTGTTGCTCCCTGGGG - Intronic
1182477758 22:30585413-30585435 AATCCAGGTGTCGTTACTTGTGG - Intronic
1182956774 22:34434128-34434150 AATGCAGGTGTTGTCATCTGGGG - Intergenic
949135418 3:559306-559328 AACCTAGGTGTTTTCCTTTGTGG - Intergenic
949352941 3:3143854-3143876 AATCCTTTTTTTGTTCTTTGAGG - Intronic
949386131 3:3504262-3504284 AATCTAAGTGGTATTCTTTGTGG + Intergenic
949607249 3:5666794-5666816 AATTCAGGTTTTGTTCATTTTGG - Intergenic
949784967 3:7730623-7730645 AATCCAGGTCTTGCTATTTTTGG - Intronic
953776209 3:45819559-45819581 AGTCCAGGTTCTGTTCTTTTGGG - Intergenic
956634028 3:71345453-71345475 AAACCAGGTTTTGATCTTTTTGG - Intronic
957223984 3:77419025-77419047 AATCAAGGTTTGGTTCTTTCTGG + Intronic
957292987 3:78301312-78301334 AATGTAGCTGTTGTTCTCTGAGG - Intergenic
958880477 3:99663759-99663781 AAGCCAGGTTTTGTTTTTTGGGG + Intronic
959326754 3:104946563-104946585 ATTCCAGTTTTAGTTCTTTGAGG + Intergenic
965857542 3:173106362-173106384 AATCCACGTGTTGATTTTAGGGG - Intronic
966284720 3:178280709-178280731 ACTACAGGTTTTTTTCTTTGTGG - Intergenic
966824204 3:183950057-183950079 TATCCTGGTGTTCTTCTGTGTGG - Exonic
966862406 3:184237677-184237699 AATGCAGGTGCTGTTTTCTGTGG - Intronic
967419282 3:189255951-189255973 AATCCAGGAGCTGTTTTTTTTGG - Intronic
971106290 4:23527625-23527647 AATCCAGGAGTTGGTTTTTTGGG + Intergenic
973643996 4:52931975-52931997 CTTCCAGGTGGTCTTCTTTGGGG - Intronic
974751801 4:66151865-66151887 AATCCAGGTGTTGATCTTTCTGG - Intergenic
975935272 4:79572353-79572375 AATGCACATGTTGTTCTATGCGG + Intergenic
976770507 4:88647156-88647178 AATCCAGGTGTTCCCTTTTGAGG + Intronic
981026365 4:140080798-140080820 AAGCCAGGTGTTGGTTTTAGTGG - Intronic
983465930 4:168089822-168089844 ATTCCATGTTTTGTTTTTTGAGG - Intergenic
986298135 5:6456337-6456359 ATTCCAAGTGATGTTCTTAGAGG + Intronic
986318008 5:6604057-6604079 AATGCAGGTGGTGTGCGTTGGGG - Intronic
987588535 5:19891615-19891637 AATCCAGTTAATGTTGTTTGAGG - Intronic
987830341 5:23087254-23087276 TATCCAGGTAGTATTCTTTGGGG + Intergenic
987850495 5:23346817-23346839 AAACCAGCTGTGGTTTTTTGAGG - Intergenic
987926314 5:24346393-24346415 AGGCCAGGTTTTGTGCTTTGGGG + Intergenic
990043324 5:51398633-51398655 AATCCAGGTGGTCTCTTTTGGGG - Intergenic
991652946 5:68874665-68874687 AATCCTGTTGGTGTTTTTTGGGG - Intergenic
992356952 5:75995796-75995818 AATCCTGCTGTTATTCTATGGGG - Intergenic
993536477 5:89092803-89092825 AATCTAGTTGTGGTTCATTGGGG + Intergenic
996353066 5:122566957-122566979 AATCCAGGAGTTGTTTTCTCAGG - Intergenic
996513571 5:124344746-124344768 AAACCAATTGTTCTTCTTTGTGG + Intergenic
997888257 5:137650940-137650962 AATCCAGTTGTCGTTCCTGGGGG - Intronic
998326205 5:141282030-141282052 ACTCCAGGATTTCTTCTTTGGGG + Intergenic
1001222568 5:169914633-169914655 AATCCAGGTTGTTTTCTATGTGG - Intronic
1001272014 5:170319972-170319994 AATCAAGGTGTTGATCATGGCGG + Intergenic
1002993156 6:2256580-2256602 AATCTAGGTGATGTTCTTGTGGG - Intergenic
1003609479 6:7596693-7596715 ATTCCAGGTTTTTTTCTTTGAGG + Intronic
1003952711 6:11131275-11131297 AAGCCATGTTTTGTTCATTGTGG + Intronic
1007186918 6:39979622-39979644 AATCCAGGCCTTCTTCTCTGTGG + Intergenic
1007845016 6:44747194-44747216 AGTAAAGGTGTTGTTTTTTGTGG - Intergenic
1009420322 6:63457548-63457570 AATCCAGGTATTTTTCTATCTGG + Intergenic
1009898711 6:69784911-69784933 AATGGAGGTGTTTTTATTTGTGG - Intronic
1013770797 6:113625658-113625680 AATCCATATGTTGTTCGCTGAGG - Intergenic
1013968095 6:115980461-115980483 AATCCAGCTGAGGTTCCTTGTGG + Intronic
1014021838 6:116599898-116599920 AATTCAAGAGTGGTTCTTTGAGG + Intergenic
1014990881 6:128074994-128075016 ATTCAAGGTTTTGTTTTTTGAGG - Intronic
1015877366 6:137836585-137836607 ATTCCAGATGTTCTTCCTTGAGG + Intergenic
1016450694 6:144179437-144179459 AGTCCATTTGTTGTTCTTTAAGG + Intronic
1019120358 6:169798902-169798924 AACCCAGATGTTGGTGTTTGTGG - Intergenic
1019508022 7:1403250-1403272 AATCCAGGAGTTCTTCCTGGAGG + Intergenic
1021592017 7:22273858-22273880 AATCCAGATGTTGATCTTTCTGG - Intronic
1024544725 7:50507786-50507808 AATAGGGGTGATGTTCTTTGCGG + Intronic
1027139979 7:75650067-75650089 AAGCCAGGTGTTTTTCTTAGGGG - Intronic
1028437091 7:90816407-90816429 AATCTGGGTATTGTTCTGTGCGG + Intronic
1028847113 7:95494041-95494063 AATGCAAATGTTGTTTTTTGTGG + Intronic
1033757230 7:144404953-144404975 AATCCAGGTGTTTTGCTTTAAGG + Intronic
1033952302 7:146800255-146800277 GATGTAGGTGTTGTTCTTGGTGG - Intronic
1036614188 8:10375726-10375748 AAGCAAGATGTTGGTCTTTGAGG - Intronic
1036720744 8:11172807-11172829 ATTCTTGGTGTTTTTCTTTGGGG - Intronic
1037394856 8:18430946-18430968 AATGCAGTGATTGTTCTTTGGGG - Intergenic
1038679141 8:29650931-29650953 CATCCAGGGGTTTTTCTTTAAGG + Intergenic
1039202172 8:35107663-35107685 AATTCTGGTTTTATTCTTTGTGG + Intergenic
1039380789 8:37083114-37083136 CTTCCTGGTCTTGTTCTTTGTGG - Intergenic
1039632504 8:39127616-39127638 AATCCAGGAGCTGGTTTTTGGGG - Intronic
1042228463 8:66533831-66533853 AATCATGGTGTTGTTATTCGTGG + Intergenic
1042912485 8:73842075-73842097 AATCCAAGTTCTGTCCTTTGAGG + Intronic
1044025943 8:87172474-87172496 TCTCCAGGTATTGTTGTTTGAGG + Intronic
1044488111 8:92777505-92777527 AATGCATGTGTGTTTCTTTGGGG + Intergenic
1046670973 8:117055903-117055925 AATCCAGATGCTTTTCTTGGTGG + Intronic
1047158549 8:122350173-122350195 AATCAAGGTGTTGTTAACTGTGG - Intergenic
1048175053 8:132144437-132144459 AATTAAGGTGTTGTTCTAGGAGG + Intronic
1048204607 8:132405328-132405350 AATCCAGGAGCTGTTTTTTGTGG - Intronic
1050366103 9:4875210-4875232 AATCTAGGTGTGCTCCTTTGAGG - Intronic
1050479505 9:6075150-6075172 ATTCCAGGTGCAGTTCTCTGGGG - Intergenic
1051295102 9:15587138-15587160 AATCCAGGTGTTAGCTTTTGGGG - Intronic
1052275653 9:26673157-26673179 AATCTAAGTGTTCTTCTCTGTGG + Intergenic
1056764211 9:89434946-89434968 AATTCAGGTTTTTTTCTTTCAGG - Intronic
1058961026 9:109993226-109993248 AGTCCAGGAGTTGTTGTTTTGGG + Intronic
1062340781 9:136093124-136093146 AACCAAGGTGTTGTCCTTTTCGG - Intronic
1203778861 EBV:89451-89473 ATTCCAGGTGTGCTTCTTTTTGG + Intergenic
1186886484 X:13919338-13919360 AATAAAGATGTTGGTCTTTGAGG - Intronic
1186913871 X:14198895-14198917 AATCTATGTGTTTTTATTTGAGG + Intergenic
1188795661 X:34461266-34461288 AATGTAGGTGTTGTCCCTTGTGG + Intergenic
1193341070 X:80350318-80350340 AATCCAGTTGTTCCTCTTTTGGG + Intronic
1196924161 X:120615827-120615849 AATCCAGCTGTTTTTGTTTGGGG - Intronic
1196983750 X:121244315-121244337 AATAAAGGTATTGTTCCTTGAGG + Intergenic
1198075739 X:133191192-133191214 TTTGCAGGAGTTGTTCTTTGTGG - Intergenic
1199480509 X:148293406-148293428 AATCCAGGTCTTGTCATTTCTGG + Intergenic
1201498327 Y:14613981-14614003 AATCTAGTTCTTGATCTTTGAGG + Intronic