ID: 927026152

View in Genome Browser
Species Human (GRCh38)
Location 2:19071165-19071187
Sequence GCCGCCCCAGTTTAGACAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927026146_927026152 0 Left 927026146 2:19071142-19071164 CCTCCCAAACTTGCCTGAAAGTA No data
Right 927026152 2:19071165-19071187 GCCGCCCCAGTTTAGACAAGGGG No data
927026144_927026152 29 Left 927026144 2:19071113-19071135 CCAAGAAAAGCATCCAGACAGTT No data
Right 927026152 2:19071165-19071187 GCCGCCCCAGTTTAGACAAGGGG No data
927026148_927026152 -4 Left 927026148 2:19071146-19071168 CCAAACTTGCCTGAAAGTAGCCG No data
Right 927026152 2:19071165-19071187 GCCGCCCCAGTTTAGACAAGGGG No data
927026145_927026152 16 Left 927026145 2:19071126-19071148 CCAGACAGTTCATTTACCTCCCA No data
Right 927026152 2:19071165-19071187 GCCGCCCCAGTTTAGACAAGGGG No data
927026147_927026152 -3 Left 927026147 2:19071145-19071167 CCCAAACTTGCCTGAAAGTAGCC No data
Right 927026152 2:19071165-19071187 GCCGCCCCAGTTTAGACAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927026152 Original CRISPR GCCGCCCCAGTTTAGACAAG GGG Intergenic
No off target data available for this crispr