ID: 927026242

View in Genome Browser
Species Human (GRCh38)
Location 2:19071963-19071985
Sequence AAGATTGACCCTGGCATTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927026242_927026250 6 Left 927026242 2:19071963-19071985 CCCTCAATGCCAGGGTCAATCTT No data
Right 927026250 2:19071992-19072014 GTGGTTCCTGGGTTCTATCTGGG No data
927026242_927026251 7 Left 927026242 2:19071963-19071985 CCCTCAATGCCAGGGTCAATCTT No data
Right 927026251 2:19071993-19072015 TGGTTCCTGGGTTCTATCTGGGG No data
927026242_927026247 -6 Left 927026242 2:19071963-19071985 CCCTCAATGCCAGGGTCAATCTT No data
Right 927026247 2:19071980-19072002 AATCTTGTGGCAGTGGTTCCTGG No data
927026242_927026249 5 Left 927026242 2:19071963-19071985 CCCTCAATGCCAGGGTCAATCTT No data
Right 927026249 2:19071991-19072013 AGTGGTTCCTGGGTTCTATCTGG No data
927026242_927026248 -5 Left 927026242 2:19071963-19071985 CCCTCAATGCCAGGGTCAATCTT No data
Right 927026248 2:19071981-19072003 ATCTTGTGGCAGTGGTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927026242 Original CRISPR AAGATTGACCCTGGCATTGA GGG (reversed) Intergenic
No off target data available for this crispr