ID: 927039695

View in Genome Browser
Species Human (GRCh38)
Location 2:19215983-19216005
Sequence CTGTGACCACAAATGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927039695_927039698 -4 Left 927039695 2:19215983-19216005 CCTTCTTCCATTTGTGGTCACAG No data
Right 927039698 2:19216002-19216024 ACAGGACAGATTTGCAGAGTTGG No data
927039695_927039700 21 Left 927039695 2:19215983-19216005 CCTTCTTCCATTTGTGGTCACAG No data
Right 927039700 2:19216027-19216049 ATGCTAAACCACACGTATTAGGG No data
927039695_927039699 20 Left 927039695 2:19215983-19216005 CCTTCTTCCATTTGTGGTCACAG No data
Right 927039699 2:19216026-19216048 GATGCTAAACCACACGTATTAGG No data
927039695_927039702 30 Left 927039695 2:19215983-19216005 CCTTCTTCCATTTGTGGTCACAG No data
Right 927039702 2:19216036-19216058 CACACGTATTAGGGATTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927039695 Original CRISPR CTGTGACCACAAATGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr